Incidental Mutation 'R3950:Zfp280d'
ID307871
Institutional Source Beutler Lab
Gene Symbol Zfp280d
Ensembl Gene ENSMUSG00000038535
Gene Namezinc finger protein 280D
SynonymsSuhw4
MMRRC Submission 040930-MU
Accession Numbers

Ncbi RefSeq: NM_146224.4; MGI:2384583

Is this an essential gene? Possibly non essential (E-score: 0.421) question?
Stock #R3950 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location72274860-72363777 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 72296019 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 16 (Q16H)
Ref Sequence ENSEMBL: ENSMUSP00000139250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098576] [ENSMUST00000183410] [ENSMUST00000183801] [ENSMUST00000184036] [ENSMUST00000184053] [ENSMUST00000184399] [ENSMUST00000184517]
Predicted Effect probably benign
Transcript: ENSMUST00000098576
AA Change: Q16H

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000096175
Gene: ENSMUSG00000038535
AA Change: Q16H

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 241 6.8e-82 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
low complexity region 539 561 N/A INTRINSIC
low complexity region 591 611 N/A INTRINSIC
ZnF_C2H2 656 679 1.23e1 SMART
ZnF_C2H2 702 726 1.34e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183400
Predicted Effect possibly damaging
Transcript: ENSMUST00000183410
AA Change: Q16H

PolyPhen 2 Score 0.489 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139250
Gene: ENSMUSG00000038535
AA Change: Q16H

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 242 4.1e-98 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
low complexity region 539 561 N/A INTRINSIC
low complexity region 591 611 N/A INTRINSIC
ZnF_C2H2 656 679 1.23e1 SMART
ZnF_C2H2 702 726 1.34e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183801
AA Change: Q16H

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139091
Gene: ENSMUSG00000038535
AA Change: Q16H

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 242 1.9e-98 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184036
SMART Domains Protein: ENSMUSP00000138857
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 18 30 N/A INTRINSIC
Pfam:DUF4195 32 217 5.5e-98 PFAM
ZnF_C2H2 227 247 1.24e2 SMART
ZnF_C2H2 308 330 6.92e0 SMART
ZnF_C2H2 345 368 3.99e0 SMART
ZnF_C2H2 375 398 1.08e-1 SMART
ZnF_C2H2 405 428 3.52e-1 SMART
ZnF_C2H2 434 456 2.41e1 SMART
ZnF_C2H2 462 484 3.38e1 SMART
low complexity region 514 536 N/A INTRINSIC
low complexity region 566 586 N/A INTRINSIC
ZnF_C2H2 631 654 1.23e1 SMART
ZnF_C2H2 677 701 1.34e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184053
AA Change: Q16H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138848
Gene: ENSMUSG00000038535
AA Change: Q16H

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 147 1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184399
AA Change: Q16H

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138902
Gene: ENSMUSG00000038535
AA Change: Q16H

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 103 4.8e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000184517
AA Change: Q16H

PolyPhen 2 Score 0.470 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138970
Gene: ENSMUSG00000038535
AA Change: Q16H

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 242 2.2e-98 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
low complexity region 539 561 N/A INTRINSIC
low complexity region 591 611 N/A INTRINSIC
ZnF_C2H2 656 679 1.23e1 SMART
ZnF_C2H2 702 726 1.34e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184786
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI

All alleles(100) : Targeted(2) Gene trapped(98)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,664,403 probably null Het
Ahnak2 A T 12: 112,785,789 I186N probably damaging Het
Appbp2 A G 11: 85,194,706 I458T probably damaging Het
Arhgef25 T C 10: 127,185,144 Y291C probably damaging Het
Ate1 T C 7: 130,467,292 Y415C probably damaging Het
B4galt4 G T 16: 38,768,022 A72S probably benign Het
C3 T C 17: 57,225,286 R178G probably benign Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Col11a1 T C 3: 114,121,445 probably null Het
Col22a1 A G 15: 71,977,358 F294L possibly damaging Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Dync2h1 A T 9: 7,112,061 Y276* probably null Het
Eea1 A T 10: 96,042,134 N1389I probably damaging Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T A 6: 23,247,420 K219* probably null Het
Fsd1 G A 17: 55,995,517 probably null Het
Haspin A G 11: 73,136,395 Y623H probably damaging Het
Hsd3b1 C T 3: 98,856,138 V56M possibly damaging Het
Hyou1 C T 9: 44,385,227 T483I probably damaging Het
Kdm2a A G 19: 4,343,232 L365S possibly damaging Het
Kdm6b G T 11: 69,405,615 P609T probably damaging Het
Klhl18 T A 9: 110,428,902 Y490F probably damaging Het
Ky C T 9: 102,542,428 Q545* probably null Het
L1td1 T C 4: 98,737,353 L595P probably benign Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Mug1 T A 6: 121,878,530 V941E probably damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Ninl A T 2: 150,952,488 I740K possibly damaging Het
Npepl1 A G 2: 174,121,113 N431D probably damaging Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Pacs2 T C 12: 113,061,113 S408P probably damaging Het
Pard6b C T 2: 168,099,194 T367I probably damaging Het
Pcdhga7 A G 18: 37,716,515 E525G probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pcx C T 19: 4,617,967 H506Y probably benign Het
Pdhx A G 2: 103,035,241 S199P probably damaging Het
Pdia2 C A 17: 26,197,616 probably null Het
Pif1 C A 9: 65,591,834 N445K probably damaging Het
Prickle4 T C 17: 47,688,582 K349E probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 A T 13: 48,589,194 M173K probably damaging Het
Rb1 A G 14: 73,262,662 L515P probably damaging Het
Rcvrn A G 11: 67,700,051 K154E probably damaging Het
Ros1 C T 10: 52,066,388 V2059I probably damaging Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Sema5a T C 15: 32,689,338 Y1050H probably damaging Het
Slc25a28 C T 19: 43,664,269 V318I probably benign Het
Srek1 G A 13: 103,744,895 R408W unknown Het
Synrg C T 11: 83,989,815 T444I probably damaging Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Tmem127 T C 2: 127,248,657 L31P probably damaging Het
Tmprss15 T A 16: 79,073,186 T190S probably benign Het
Trip10 T A 17: 57,253,411 probably null Het
Ttc6 A G 12: 57,649,506 Y31C probably damaging Het
Unc80 A T 1: 66,622,570 H1718L possibly damaging Het
Zbtb38 A G 9: 96,687,546 F495S probably damaging Het
Zfp521 A G 18: 13,846,346 S337P probably damaging Het
Zswim9 T A 7: 13,261,577 T218S possibly damaging Het
Other mutations in Zfp280d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Zfp280d APN 9 72322571 missense probably damaging 1.00
IGL00708:Zfp280d APN 9 72312135 missense probably benign 0.19
IGL01333:Zfp280d APN 9 72335114 splice site probably benign
IGL01453:Zfp280d APN 9 72322586 missense possibly damaging 0.90
IGL02472:Zfp280d APN 9 72301711 missense probably damaging 1.00
IGL02583:Zfp280d APN 9 72322445 splice site probably benign
IGL02608:Zfp280d APN 9 72307979 missense probably damaging 0.98
IGL02675:Zfp280d APN 9 72312222 missense probably benign 0.33
IGL02676:Zfp280d APN 9 72335074 missense probably damaging 1.00
IGL02931:Zfp280d APN 9 72296025 missense probably benign 0.02
IGL03076:Zfp280d APN 9 72312662 missense probably damaging 0.99
R0017:Zfp280d UTSW 9 72339010 critical splice acceptor site probably null
R0017:Zfp280d UTSW 9 72339010 critical splice acceptor site probably null
R0288:Zfp280d UTSW 9 72331339 nonsense probably null
R0419:Zfp280d UTSW 9 72312237 missense probably benign 0.02
R0540:Zfp280d UTSW 9 72307965 missense probably damaging 0.97
R0628:Zfp280d UTSW 9 72361948 missense probably benign
R0722:Zfp280d UTSW 9 72312101 missense possibly damaging 0.63
R1055:Zfp280d UTSW 9 72329167 splice site probably null
R1786:Zfp280d UTSW 9 72308005 missense probably damaging 1.00
R1826:Zfp280d UTSW 9 72298780 missense probably damaging 1.00
R1962:Zfp280d UTSW 9 72335080 nonsense probably null
R2130:Zfp280d UTSW 9 72308005 missense probably damaging 1.00
R2132:Zfp280d UTSW 9 72308005 missense probably damaging 1.00
R2133:Zfp280d UTSW 9 72308005 missense probably damaging 1.00
R2143:Zfp280d UTSW 9 72312729 missense probably damaging 1.00
R2162:Zfp280d UTSW 9 72298822 missense probably damaging 1.00
R2266:Zfp280d UTSW 9 72301770 splice site probably benign
R2269:Zfp280d UTSW 9 72301770 splice site probably benign
R2278:Zfp280d UTSW 9 72338773 nonsense probably null
R2850:Zfp280d UTSW 9 72312089 missense probably benign 0.06
R3780:Zfp280d UTSW 9 72322524 missense probably damaging 1.00
R4330:Zfp280d UTSW 9 72295979 missense possibly damaging 0.86
R4716:Zfp280d UTSW 9 72312665 missense possibly damaging 0.94
R4876:Zfp280d UTSW 9 72298858 splice site probably benign
R4909:Zfp280d UTSW 9 72331432 missense probably damaging 1.00
R5214:Zfp280d UTSW 9 72308113 unclassified probably benign
R5518:Zfp280d UTSW 9 72324135 missense probably damaging 0.99
R5853:Zfp280d UTSW 9 72330942 missense probably benign 0.20
R5945:Zfp280d UTSW 9 72362332 nonsense probably null
R6033:Zfp280d UTSW 9 72329137 missense probably damaging 1.00
R6033:Zfp280d UTSW 9 72329137 missense probably damaging 1.00
R7043:Zfp280d UTSW 9 72319257 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCACATGGTAAGCTTAAATACTT -3'
(R):5'- CTGACATAAACAGTAGCTATTTCTGTT -3'

Sequencing Primer
(F):5'- CATTACAGATGGTTGTGAGCCACC -3'
(R):5'- AAGATGGGGACCATCTCT -3'
Posted On2015-04-17