Incidental Mutation 'R3950:Klhl18'
ID307874
Institutional Source Beutler Lab
Gene Symbol Klhl18
Ensembl Gene ENSMUSG00000054792
Gene Namekelch-like 18
Synonyms
MMRRC Submission 040930-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3950 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location110425926-110476694 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110428902 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 490 (Y490F)
Ref Sequence ENSEMBL: ENSMUSP00000143634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068025] [ENSMUST00000198164] [ENSMUST00000198400]
Predicted Effect probably damaging
Transcript: ENSMUST00000068025
AA Change: Y485F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000069674
Gene: ENSMUSG00000054792
AA Change: Y485F

DomainStartEndE-ValueType
BTB 38 135 1.32e-29 SMART
BACK 140 242 1.67e-39 SMART
Kelch 289 336 1.78e-14 SMART
Kelch 337 383 2.64e-17 SMART
Kelch 384 430 2.18e-18 SMART
Kelch 431 477 9.27e-13 SMART
Kelch 478 524 3.34e-5 SMART
Kelch 525 571 1.22e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111934
AA Change: Y490F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107565
Gene: ENSMUSG00000054792
AA Change: Y490F

DomainStartEndE-ValueType
BTB 38 135 1.32e-29 SMART
BACK 140 242 1.67e-39 SMART
Kelch 289 341 8.52e-12 SMART
Kelch 342 388 2.64e-17 SMART
Kelch 389 435 2.18e-18 SMART
Kelch 436 482 9.27e-13 SMART
Kelch 483 529 3.34e-5 SMART
Kelch 530 576 1.22e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197336
Predicted Effect probably damaging
Transcript: ENSMUST00000198164
AA Change: Y490F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143634
Gene: ENSMUSG00000054792
AA Change: Y490F

DomainStartEndE-ValueType
BTB 38 135 1.32e-29 SMART
BACK 140 242 1.67e-39 SMART
Kelch 289 341 8.52e-12 SMART
Kelch 342 388 2.64e-17 SMART
Kelch 389 435 2.18e-18 SMART
Kelch 436 482 9.27e-13 SMART
Kelch 483 529 3.34e-5 SMART
Kelch 530 576 1.22e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000198400
AA Change: Y420F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143384
Gene: ENSMUSG00000054792
AA Change: Y420F

DomainStartEndE-ValueType
Pfam:BTB 1 70 2.1e-15 PFAM
BACK 75 177 1.67e-39 SMART
Kelch 224 271 1.78e-14 SMART
Kelch 272 318 2.64e-17 SMART
Kelch 319 365 2.18e-18 SMART
Kelch 366 412 9.27e-13 SMART
Kelch 413 459 3.34e-5 SMART
Kelch 460 506 1.22e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199700
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,664,403 probably null Het
Ahnak2 A T 12: 112,785,789 I186N probably damaging Het
Appbp2 A G 11: 85,194,706 I458T probably damaging Het
Arhgef25 T C 10: 127,185,144 Y291C probably damaging Het
Ate1 T C 7: 130,467,292 Y415C probably damaging Het
B4galt4 G T 16: 38,768,022 A72S probably benign Het
C3 T C 17: 57,225,286 R178G probably benign Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Col11a1 T C 3: 114,121,445 probably null Het
Col22a1 A G 15: 71,977,358 F294L possibly damaging Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Dync2h1 A T 9: 7,112,061 Y276* probably null Het
Eea1 A T 10: 96,042,134 N1389I probably damaging Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T A 6: 23,247,420 K219* probably null Het
Fsd1 G A 17: 55,995,517 probably null Het
Haspin A G 11: 73,136,395 Y623H probably damaging Het
Hsd3b1 C T 3: 98,856,138 V56M possibly damaging Het
Hyou1 C T 9: 44,385,227 T483I probably damaging Het
Kdm2a A G 19: 4,343,232 L365S possibly damaging Het
Kdm6b G T 11: 69,405,615 P609T probably damaging Het
Ky C T 9: 102,542,428 Q545* probably null Het
L1td1 T C 4: 98,737,353 L595P probably benign Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Mug1 T A 6: 121,878,530 V941E probably damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Ninl A T 2: 150,952,488 I740K possibly damaging Het
Npepl1 A G 2: 174,121,113 N431D probably damaging Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Pacs2 T C 12: 113,061,113 S408P probably damaging Het
Pard6b C T 2: 168,099,194 T367I probably damaging Het
Pcdhga7 A G 18: 37,716,515 E525G probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pcx C T 19: 4,617,967 H506Y probably benign Het
Pdhx A G 2: 103,035,241 S199P probably damaging Het
Pdia2 C A 17: 26,197,616 probably null Het
Pif1 C A 9: 65,591,834 N445K probably damaging Het
Prickle4 T C 17: 47,688,582 K349E probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 A T 13: 48,589,194 M173K probably damaging Het
Rb1 A G 14: 73,262,662 L515P probably damaging Het
Rcvrn A G 11: 67,700,051 K154E probably damaging Het
Ros1 C T 10: 52,066,388 V2059I probably damaging Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Sema5a T C 15: 32,689,338 Y1050H probably damaging Het
Slc25a28 C T 19: 43,664,269 V318I probably benign Het
Srek1 G A 13: 103,744,895 R408W unknown Het
Synrg C T 11: 83,989,815 T444I probably damaging Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Tmem127 T C 2: 127,248,657 L31P probably damaging Het
Tmprss15 T A 16: 79,073,186 T190S probably benign Het
Trip10 T A 17: 57,253,411 probably null Het
Ttc6 A G 12: 57,649,506 Y31C probably damaging Het
Unc80 A T 1: 66,622,570 H1718L possibly damaging Het
Zbtb38 A G 9: 96,687,546 F495S probably damaging Het
Zfp280d G T 9: 72,296,019 Q16H possibly damaging Het
Zfp521 A G 18: 13,846,346 S337P probably damaging Het
Zswim9 T A 7: 13,261,577 T218S possibly damaging Het
Other mutations in Klhl18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Klhl18 APN 9 110428686 missense probably damaging 1.00
IGL01338:Klhl18 APN 9 110455433 missense probably damaging 1.00
IGL01455:Klhl18 APN 9 110432443 missense probably damaging 1.00
IGL01954:Klhl18 APN 9 110428866 missense probably damaging 1.00
IGL01960:Klhl18 APN 9 110450746 missense probably benign 0.25
IGL02195:Klhl18 APN 9 110438902 missense possibly damaging 0.92
IGL02430:Klhl18 APN 9 110437401 missense probably benign 0.25
IGL02629:Klhl18 APN 9 110429938 splice site probably benign
mixie UTSW 9 110436062 missense probably benign 0.00
R0389:Klhl18 UTSW 9 110428681 missense probably benign 0.00
R1538:Klhl18 UTSW 9 110446747 missense probably damaging 1.00
R1777:Klhl18 UTSW 9 110437401 missense probably benign 0.25
R1966:Klhl18 UTSW 9 110476590 missense probably benign 0.14
R2099:Klhl18 UTSW 9 110455418 missense probably damaging 1.00
R3699:Klhl18 UTSW 9 110436066 missense probably benign 0.06
R3911:Klhl18 UTSW 9 110436083 missense probably damaging 1.00
R4197:Klhl18 UTSW 9 110429944 critical splice donor site probably null
R4500:Klhl18 UTSW 9 110429966 missense probably damaging 1.00
R4936:Klhl18 UTSW 9 110428961 missense possibly damaging 0.88
R5296:Klhl18 UTSW 9 110436127 missense possibly damaging 0.64
R5298:Klhl18 UTSW 9 110436127 missense possibly damaging 0.64
R5301:Klhl18 UTSW 9 110436127 missense possibly damaging 0.64
R5407:Klhl18 UTSW 9 110436127 missense possibly damaging 0.64
R5433:Klhl18 UTSW 9 110436127 missense possibly damaging 0.64
R5641:Klhl18 UTSW 9 110446828 missense probably damaging 1.00
R6084:Klhl18 UTSW 9 110428727 missense possibly damaging 0.52
R6279:Klhl18 UTSW 9 110436062 missense probably benign 0.00
R6300:Klhl18 UTSW 9 110436062 missense probably benign 0.00
R6425:Klhl18 UTSW 9 110446681 missense possibly damaging 0.85
R6465:Klhl18 UTSW 9 110428920 missense probably benign 0.21
R6521:Klhl18 UTSW 9 110428635 missense possibly damaging 0.92
R6587:Klhl18 UTSW 9 110455426 missense probably damaging 1.00
R6730:Klhl18 UTSW 9 110428911 missense probably damaging 0.98
R7110:Klhl18 UTSW 9 110450765 missense probably damaging 0.99
R7492:Klhl18 UTSW 9 110428775 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCACTGAGCTTAGGTTTGACTG -3'
(R):5'- GCATCAGAGCAAGGGTACAC -3'

Sequencing Primer
(F):5'- AGGTTTGACTGTCCATCGTAAC -3'
(R):5'- CACCGTGTAGGCTTCTGTGC -3'
Posted On2015-04-17