Incidental Mutation 'R3950:Arhgef25'
ID307882
Institutional Source Beutler Lab
Gene Symbol Arhgef25
Ensembl Gene ENSMUSG00000019467
Gene NameRho guanine nucleotide exchange factor (GEF) 25
SynonymsD10Ertd610e, 2410008H17Rik, GEFT
MMRRC Submission 040930-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R3950 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location127182525-127190083 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127185144 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 291 (Y291C)
Ref Sequence ENSEMBL: ENSMUSP00000152503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019611] [ENSMUST00000095270] [ENSMUST00000167353] [ENSMUST00000218587] [ENSMUST00000218654] [ENSMUST00000219245] [ENSMUST00000222006] [ENSMUST00000222911]
Predicted Effect probably damaging
Transcript: ENSMUST00000019611
AA Change: Y291C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019611
Gene: ENSMUSG00000019467
AA Change: Y291C

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 81 103 N/A INTRINSIC
low complexity region 146 171 N/A INTRINSIC
RhoGEF 203 374 2.45e-49 SMART
PH 394 507 6.67e-1 SMART
low complexity region 561 569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095270
SMART Domains Protein: ENSMUSP00000092904
Gene: ENSMUSG00000040441

DomainStartEndE-ValueType
low complexity region 51 78 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
Pfam:Sulfate_transp 105 497 5.5e-103 PFAM
low complexity region 512 522 N/A INTRINSIC
Pfam:STAS 549 664 3.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167353
AA Change: Y282C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126339
Gene: ENSMUSG00000019467
AA Change: Y282C

DomainStartEndE-ValueType
low complexity region 72 94 N/A INTRINSIC
low complexity region 137 162 N/A INTRINSIC
RhoGEF 194 365 2.45e-49 SMART
PH 385 498 6.67e-1 SMART
low complexity region 552 560 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218478
Predicted Effect probably benign
Transcript: ENSMUST00000218587
Predicted Effect probably damaging
Transcript: ENSMUST00000218654
AA Change: Y252C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000218864
Predicted Effect probably benign
Transcript: ENSMUST00000219245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221174
Predicted Effect probably damaging
Transcript: ENSMUST00000222006
AA Change: Y291C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222911
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases alternate between an inactive GDP-bound state and an active GTP-bound state, and GEFs facilitate GDP/GTP exchange. This gene encodes a guanine nucleotide exchange factor (GEF) which interacts with Rho GTPases involved in contraction of vascular smooth muscles, regulation of responses to angiotensin II and lens cell differentiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a conditional allele activated in the second heart field exhibit normal cardiac development and prenatal survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,664,403 probably null Het
Ahnak2 A T 12: 112,785,789 I186N probably damaging Het
Appbp2 A G 11: 85,194,706 I458T probably damaging Het
Ate1 T C 7: 130,467,292 Y415C probably damaging Het
B4galt4 G T 16: 38,768,022 A72S probably benign Het
C3 T C 17: 57,225,286 R178G probably benign Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Col11a1 T C 3: 114,121,445 probably null Het
Col22a1 A G 15: 71,977,358 F294L possibly damaging Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Dync2h1 A T 9: 7,112,061 Y276* probably null Het
Eea1 A T 10: 96,042,134 N1389I probably damaging Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T A 6: 23,247,420 K219* probably null Het
Fsd1 G A 17: 55,995,517 probably null Het
Haspin A G 11: 73,136,395 Y623H probably damaging Het
Hsd3b1 C T 3: 98,856,138 V56M possibly damaging Het
Hyou1 C T 9: 44,385,227 T483I probably damaging Het
Kdm2a A G 19: 4,343,232 L365S possibly damaging Het
Kdm6b G T 11: 69,405,615 P609T probably damaging Het
Klhl18 T A 9: 110,428,902 Y490F probably damaging Het
Ky C T 9: 102,542,428 Q545* probably null Het
L1td1 T C 4: 98,737,353 L595P probably benign Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Mug1 T A 6: 121,878,530 V941E probably damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Ninl A T 2: 150,952,488 I740K possibly damaging Het
Npepl1 A G 2: 174,121,113 N431D probably damaging Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Pacs2 T C 12: 113,061,113 S408P probably damaging Het
Pard6b C T 2: 168,099,194 T367I probably damaging Het
Pcdhga7 A G 18: 37,716,515 E525G probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pcx C T 19: 4,617,967 H506Y probably benign Het
Pdhx A G 2: 103,035,241 S199P probably damaging Het
Pdia2 C A 17: 26,197,616 probably null Het
Pif1 C A 9: 65,591,834 N445K probably damaging Het
Prickle4 T C 17: 47,688,582 K349E probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 A T 13: 48,589,194 M173K probably damaging Het
Rb1 A G 14: 73,262,662 L515P probably damaging Het
Rcvrn A G 11: 67,700,051 K154E probably damaging Het
Ros1 C T 10: 52,066,388 V2059I probably damaging Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Sema5a T C 15: 32,689,338 Y1050H probably damaging Het
Slc25a28 C T 19: 43,664,269 V318I probably benign Het
Srek1 G A 13: 103,744,895 R408W unknown Het
Synrg C T 11: 83,989,815 T444I probably damaging Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Tmem127 T C 2: 127,248,657 L31P probably damaging Het
Tmprss15 T A 16: 79,073,186 T190S probably benign Het
Trip10 T A 17: 57,253,411 probably null Het
Ttc6 A G 12: 57,649,506 Y31C probably damaging Het
Unc80 A T 1: 66,622,570 H1718L possibly damaging Het
Zbtb38 A G 9: 96,687,546 F495S probably damaging Het
Zfp280d G T 9: 72,296,019 Q16H possibly damaging Het
Zfp521 A G 18: 13,846,346 S337P probably damaging Het
Zswim9 T A 7: 13,261,577 T218S possibly damaging Het
Other mutations in Arhgef25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Arhgef25 APN 10 127184170 missense probably damaging 1.00
IGL02499:Arhgef25 APN 10 127185591 missense probably damaging 1.00
IGL03276:Arhgef25 APN 10 127185925 missense possibly damaging 0.78
R0021:Arhgef25 UTSW 10 127189554 missense probably benign 0.00
R0038:Arhgef25 UTSW 10 127186865 splice site probably benign
R0038:Arhgef25 UTSW 10 127186865 splice site probably benign
R0106:Arhgef25 UTSW 10 127184010 critical splice donor site probably null
R0242:Arhgef25 UTSW 10 127184064 missense probably damaging 1.00
R0242:Arhgef25 UTSW 10 127184064 missense probably damaging 1.00
R0358:Arhgef25 UTSW 10 127184453 missense probably damaging 1.00
R0505:Arhgef25 UTSW 10 127183697 missense probably null 0.03
R0676:Arhgef25 UTSW 10 127184010 critical splice donor site probably null
R1185:Arhgef25 UTSW 10 127183781 missense possibly damaging 0.85
R1185:Arhgef25 UTSW 10 127183781 missense possibly damaging 0.85
R1185:Arhgef25 UTSW 10 127183781 missense possibly damaging 0.85
R1600:Arhgef25 UTSW 10 127185289 missense probably damaging 0.99
R1846:Arhgef25 UTSW 10 127185864 missense probably damaging 1.00
R2055:Arhgef25 UTSW 10 127185135 missense probably damaging 1.00
R2254:Arhgef25 UTSW 10 127189521 missense probably benign 0.01
R2496:Arhgef25 UTSW 10 127187194 missense probably benign 0.08
R3836:Arhgef25 UTSW 10 127189736 missense probably benign
R3837:Arhgef25 UTSW 10 127189736 missense probably benign
R3838:Arhgef25 UTSW 10 127189736 missense probably benign
R3839:Arhgef25 UTSW 10 127189736 missense probably benign
R3980:Arhgef25 UTSW 10 127187220 missense probably damaging 1.00
R4883:Arhgef25 UTSW 10 127182933 missense probably benign 0.43
R4964:Arhgef25 UTSW 10 127185603 missense probably damaging 1.00
R5192:Arhgef25 UTSW 10 127185109 missense probably damaging 1.00
R5196:Arhgef25 UTSW 10 127185109 missense probably damaging 1.00
R5420:Arhgef25 UTSW 10 127187274 missense probably benign 0.37
R6301:Arhgef25 UTSW 10 127185882 missense possibly damaging 0.88
R6764:Arhgef25 UTSW 10 127184101 missense probably damaging 1.00
R7096:Arhgef25 UTSW 10 127184028 missense probably damaging 1.00
R7289:Arhgef25 UTSW 10 127183772 missense possibly damaging 0.92
X0018:Arhgef25 UTSW 10 127183699 missense probably damaging 1.00
X0024:Arhgef25 UTSW 10 127183257 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCGCTGCACTGGTTTAATGAG -3'
(R):5'- GGTTGGCTCAGCTGTTCATC -3'

Sequencing Primer
(F):5'- AGGTCATTGAGCTGCAGTC -3'
(R):5'- GGCTCAGCTGTTCATCAAACATG -3'
Posted On2015-04-17