Incidental Mutation 'R3950:Appbp2'
ID307887
Institutional Source Beutler Lab
Gene Symbol Appbp2
Ensembl Gene ENSMUSG00000018481
Gene Nameamyloid beta precursor protein (cytoplasmic tail) binding protein 2
SynonymsPAT1, 1300003O07Rik
MMRRC Submission 040930-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.645) question?
Stock #R3950 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location85187262-85235130 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85194706 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 458 (I458T)
Ref Sequence ENSEMBL: ENSMUSP00000018625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018625]
Predicted Effect probably damaging
Transcript: ENSMUST00000018625
AA Change: I458T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018625
Gene: ENSMUSG00000018481
AA Change: I458T

DomainStartEndE-ValueType
Pfam:TPR_12 395 461 6.5e-13 PFAM
Pfam:TPR_10 428 467 1.1e-9 PFAM
Pfam:TPR_7 432 466 1.2e-5 PFAM
Pfam:TPR_10 470 509 8.9e-7 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with microtubules and is functionally associated with beta-amyloid precursor protein transport and/or processing. The beta-amyloid precursor protein is a cell surface protein with signal-transducing properties, and it is thought to play a role in the pathogenesis of Alzheimer's disease. The encoded protein may be involved in regulating cell death. This gene has been found to be highly expressed in breast cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,664,403 probably null Het
Ahnak2 A T 12: 112,785,789 I186N probably damaging Het
Arhgef25 T C 10: 127,185,144 Y291C probably damaging Het
Ate1 T C 7: 130,467,292 Y415C probably damaging Het
B4galt4 G T 16: 38,768,022 A72S probably benign Het
C3 T C 17: 57,225,286 R178G probably benign Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Col11a1 T C 3: 114,121,445 probably null Het
Col22a1 A G 15: 71,977,358 F294L possibly damaging Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Dync2h1 A T 9: 7,112,061 Y276* probably null Het
Eea1 A T 10: 96,042,134 N1389I probably damaging Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T A 6: 23,247,420 K219* probably null Het
Fsd1 G A 17: 55,995,517 probably null Het
Haspin A G 11: 73,136,395 Y623H probably damaging Het
Hsd3b1 C T 3: 98,856,138 V56M possibly damaging Het
Hyou1 C T 9: 44,385,227 T483I probably damaging Het
Kdm2a A G 19: 4,343,232 L365S possibly damaging Het
Kdm6b G T 11: 69,405,615 P609T probably damaging Het
Klhl18 T A 9: 110,428,902 Y490F probably damaging Het
Ky C T 9: 102,542,428 Q545* probably null Het
L1td1 T C 4: 98,737,353 L595P probably benign Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Mug1 T A 6: 121,878,530 V941E probably damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Ninl A T 2: 150,952,488 I740K possibly damaging Het
Npepl1 A G 2: 174,121,113 N431D probably damaging Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Pacs2 T C 12: 113,061,113 S408P probably damaging Het
Pard6b C T 2: 168,099,194 T367I probably damaging Het
Pcdhga7 A G 18: 37,716,515 E525G probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pcx C T 19: 4,617,967 H506Y probably benign Het
Pdhx A G 2: 103,035,241 S199P probably damaging Het
Pdia2 C A 17: 26,197,616 probably null Het
Pif1 C A 9: 65,591,834 N445K probably damaging Het
Prickle4 T C 17: 47,688,582 K349E probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 A T 13: 48,589,194 M173K probably damaging Het
Rb1 A G 14: 73,262,662 L515P probably damaging Het
Rcvrn A G 11: 67,700,051 K154E probably damaging Het
Ros1 C T 10: 52,066,388 V2059I probably damaging Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Sema5a T C 15: 32,689,338 Y1050H probably damaging Het
Slc25a28 C T 19: 43,664,269 V318I probably benign Het
Srek1 G A 13: 103,744,895 R408W unknown Het
Synrg C T 11: 83,989,815 T444I probably damaging Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Tmem127 T C 2: 127,248,657 L31P probably damaging Het
Tmprss15 T A 16: 79,073,186 T190S probably benign Het
Trip10 T A 17: 57,253,411 probably null Het
Ttc6 A G 12: 57,649,506 Y31C probably damaging Het
Unc80 A T 1: 66,622,570 H1718L possibly damaging Het
Zbtb38 A G 9: 96,687,546 F495S probably damaging Het
Zfp280d G T 9: 72,296,019 Q16H possibly damaging Het
Zfp521 A G 18: 13,846,346 S337P probably damaging Het
Zswim9 T A 7: 13,261,577 T218S possibly damaging Het
Other mutations in Appbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Appbp2 APN 11 85214317 missense possibly damaging 0.86
IGL02112:Appbp2 APN 11 85201620 missense probably benign 0.04
IGL03051:Appbp2 APN 11 85191739 missense possibly damaging 0.90
IGL03068:Appbp2 APN 11 85201420 missense probably damaging 1.00
IGL03260:Appbp2 APN 11 85216457 missense probably benign 0.00
IGL03358:Appbp2 APN 11 85210034 missense probably benign 0.17
R0017:Appbp2 UTSW 11 85214303 missense possibly damaging 0.46
R0267:Appbp2 UTSW 11 85201462 missense probably damaging 1.00
R0504:Appbp2 UTSW 11 85191687 missense probably benign 0.05
R1661:Appbp2 UTSW 11 85210110 critical splice acceptor site probably null
R3438:Appbp2 UTSW 11 85198140 missense probably damaging 1.00
R3817:Appbp2 UTSW 11 85198108 missense probably damaging 1.00
R4273:Appbp2 UTSW 11 85234676 missense probably damaging 1.00
R4574:Appbp2 UTSW 11 85209938 critical splice donor site probably null
R4948:Appbp2 UTSW 11 85194583 missense possibly damaging 0.87
R5322:Appbp2 UTSW 11 85196064 critical splice donor site probably null
R5581:Appbp2 UTSW 11 85210095 missense possibly damaging 0.92
R5593:Appbp2 UTSW 11 85194583 missense possibly damaging 0.87
R5698:Appbp2 UTSW 11 85210099 missense probably damaging 1.00
R7095:Appbp2 UTSW 11 85234727 nonsense probably null
R7141:Appbp2 UTSW 11 85191751 nonsense probably null
X0058:Appbp2 UTSW 11 85201630 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGTCAGCAGGATCTAGGAGC -3'
(R):5'- CCAGTAATGTTTTGCAGCAGC -3'

Sequencing Primer
(F):5'- ATCTAGGAGCACAGACAAGC -3'
(R):5'- CAGCAGCTTTCGGAAAAGGC -3'
Posted On2015-04-17