Incidental Mutation 'R3950:Prickle4'
ID307902
Institutional Source Beutler Lab
Gene Symbol Prickle4
Ensembl Gene ENSMUSG00000096549
Gene Nameprickle planar cell polarity protein 4
SynonymsLOC381104
MMRRC Submission 040930-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3950 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location47688517-47694736 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47688582 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 349 (K349E)
Ref Sequence ENSEMBL: ENSMUSP00000119045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024779] [ENSMUST00000113299] [ENSMUST00000113300] [ENSMUST00000113301] [ENSMUST00000113302] [ENSMUST00000132397] [ENSMUST00000143789] [ENSMUST00000156118]
Predicted Effect probably benign
Transcript: ENSMUST00000024779
SMART Domains Protein: ENSMUSP00000024779
Gene: ENSMUSG00000090115

DomainStartEndE-ValueType
ZnF_UBP 25 74 4.21e-17 SMART
coiled coil region 165 203 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
Pfam:UCH 249 651 5.4e-61 PFAM
Pfam:UCH_1 337 633 3.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113299
AA Change: K309E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000108924
Gene: ENSMUSG00000096549
AA Change: K309E

DomainStartEndE-ValueType
Pfam:PET 22 74 2.7e-13 PFAM
LIM 83 140 1.56e-7 SMART
LIM 148 200 1.28e-12 SMART
low complexity region 207 221 N/A INTRINSIC
low complexity region 282 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113300
AA Change: K349E

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000108925
Gene: ENSMUSG00000096549
AA Change: K349E

DomainStartEndE-ValueType
Pfam:PET 62 114 6e-13 PFAM
LIM 123 180 1.56e-7 SMART
LIM 188 240 1.28e-12 SMART
low complexity region 247 261 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113301
SMART Domains Protein: ENSMUSP00000108926
Gene: ENSMUSG00000033475

DomainStartEndE-ValueType
Pfam:TOMM6 1 74 4.1e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113302
SMART Domains Protein: ENSMUSP00000108927
Gene: ENSMUSG00000033475

DomainStartEndE-ValueType
Pfam:TOM6p 1 74 5.2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132397
SMART Domains Protein: ENSMUSP00000117658
Gene: ENSMUSG00000023984

DomainStartEndE-ValueType
Pfam:Med20 1 149 1.6e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143156
Predicted Effect probably benign
Transcript: ENSMUST00000143789
AA Change: K349E

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000119045
Gene: ENSMUSG00000079444
AA Change: K349E

DomainStartEndE-ValueType
Pfam:PET 66 116 8.6e-12 PFAM
LIM 123 180 1.56e-7 SMART
LIM 188 240 1.28e-12 SMART
low complexity region 247 261 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151540
Predicted Effect probably benign
Transcript: ENSMUST00000152214
SMART Domains Protein: ENSMUSP00000121465
Gene: ENSMUSG00000096549

DomainStartEndE-ValueType
Pfam:PET 3 50 7.4e-14 PFAM
LIM 59 116 1.56e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155812
Predicted Effect probably benign
Transcript: ENSMUST00000156118
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C6ORF49 is a member of the LIM domain protein family (Teufel et al., 2005 [PubMed 15702247]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,664,403 probably null Het
Ahnak2 A T 12: 112,785,789 I186N probably damaging Het
Appbp2 A G 11: 85,194,706 I458T probably damaging Het
Arhgef25 T C 10: 127,185,144 Y291C probably damaging Het
Ate1 T C 7: 130,467,292 Y415C probably damaging Het
B4galt4 G T 16: 38,768,022 A72S probably benign Het
C3 T C 17: 57,225,286 R178G probably benign Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Col11a1 T C 3: 114,121,445 probably null Het
Col22a1 A G 15: 71,977,358 F294L possibly damaging Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Dync2h1 A T 9: 7,112,061 Y276* probably null Het
Eea1 A T 10: 96,042,134 N1389I probably damaging Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T A 6: 23,247,420 K219* probably null Het
Fsd1 G A 17: 55,995,517 probably null Het
Haspin A G 11: 73,136,395 Y623H probably damaging Het
Hsd3b1 C T 3: 98,856,138 V56M possibly damaging Het
Hyou1 C T 9: 44,385,227 T483I probably damaging Het
Kdm2a A G 19: 4,343,232 L365S possibly damaging Het
Kdm6b G T 11: 69,405,615 P609T probably damaging Het
Klhl18 T A 9: 110,428,902 Y490F probably damaging Het
Ky C T 9: 102,542,428 Q545* probably null Het
L1td1 T C 4: 98,737,353 L595P probably benign Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Mug1 T A 6: 121,878,530 V941E probably damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Ninl A T 2: 150,952,488 I740K possibly damaging Het
Npepl1 A G 2: 174,121,113 N431D probably damaging Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Pacs2 T C 12: 113,061,113 S408P probably damaging Het
Pard6b C T 2: 168,099,194 T367I probably damaging Het
Pcdhga7 A G 18: 37,716,515 E525G probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pcx C T 19: 4,617,967 H506Y probably benign Het
Pdhx A G 2: 103,035,241 S199P probably damaging Het
Pdia2 C A 17: 26,197,616 probably null Het
Pif1 C A 9: 65,591,834 N445K probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 A T 13: 48,589,194 M173K probably damaging Het
Rb1 A G 14: 73,262,662 L515P probably damaging Het
Rcvrn A G 11: 67,700,051 K154E probably damaging Het
Ros1 C T 10: 52,066,388 V2059I probably damaging Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Sema5a T C 15: 32,689,338 Y1050H probably damaging Het
Slc25a28 C T 19: 43,664,269 V318I probably benign Het
Srek1 G A 13: 103,744,895 R408W unknown Het
Synrg C T 11: 83,989,815 T444I probably damaging Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Tmem127 T C 2: 127,248,657 L31P probably damaging Het
Tmprss15 T A 16: 79,073,186 T190S probably benign Het
Trip10 T A 17: 57,253,411 probably null Het
Ttc6 A G 12: 57,649,506 Y31C probably damaging Het
Unc80 A T 1: 66,622,570 H1718L possibly damaging Het
Zbtb38 A G 9: 96,687,546 F495S probably damaging Het
Zfp280d G T 9: 72,296,019 Q16H possibly damaging Het
Zfp521 A G 18: 13,846,346 S337P probably damaging Het
Zswim9 T A 7: 13,261,577 T218S possibly damaging Het
Other mutations in Prickle4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02059:Prickle4 APN 17 47690249 missense probably damaging 0.99
R1225:Prickle4 UTSW 17 47688689 unclassified probably null
R1867:Prickle4 UTSW 17 47690119 missense possibly damaging 0.88
R4328:Prickle4 UTSW 17 47688618 missense probably damaging 1.00
R4398:Prickle4 UTSW 17 47690531 intron probably benign
R4890:Prickle4 UTSW 17 47689881 intron probably benign
R5155:Prickle4 UTSW 17 47690057 critical splice donor site probably null
R5801:Prickle4 UTSW 17 47688773 missense possibly damaging 0.90
R6056:Prickle4 UTSW 17 47690210 missense probably damaging 1.00
R6528:Prickle4 UTSW 17 47689333 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGTGCAGTACCAATGGGATTATC -3'
(R):5'- GATGACAAGATCACCTCCCG -3'

Sequencing Primer
(F):5'- ATTATCCCGCGTGCCTGG -3'
(R):5'- AGATCACCTCCCGAGCTG -3'
Posted On2015-04-17