Incidental Mutation 'R3951:Map3k20'
ID307918
Institutional Source Beutler Lab
Gene Symbol Map3k20
Ensembl Gene ENSMUSG00000004085
Gene Namemitogen-activated protein kinase kinase kinase 20
SynonymsMLTKalpha, Zak, MLTKbeta, B230120H23Rik
MMRRC Submission 040828-MU
Accession Numbers

Genbank: NM_023057, NM_178084; MGI: 2443258

Is this an essential gene? Possibly essential (E-score: 0.713) question?
Stock #R3951 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location72285637-72442610 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 72438300 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 550 (I550M)
Ref Sequence ENSEMBL: ENSMUSP00000088334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090824]
Predicted Effect probably damaging
Transcript: ENSMUST00000090824
AA Change: I550M

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000088334
Gene: ENSMUSG00000004085
AA Change: I550M

DomainStartEndE-ValueType
Pfam:Pkinase 16 259 6.3e-56 PFAM
Pfam:Pkinase_Tyr 16 260 9.9e-64 PFAM
coiled coil region 277 328 N/A INTRINSIC
SAM 336 410 5.59e-7 SMART
low complexity region 643 668 N/A INTRINSIC
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MAPKKK family of signal transduction molecules and encodes a protein with an N-terminal kinase catalytic domain, followed by a leucine zipper motif and a sterile-alpha motif (SAM). This magnesium-binding protein forms homodimers and is located in the cytoplasm. The protein mediates gamma radiation signaling leading to cell cycle arrest and activity of this protein plays a role in cell cycle checkpoint regulation in cells. The protein also has pro-apoptotic activity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete lethality at E9.5 with growth retardation. Mice homozygous for an allele lacking the SAM domain exhibit low penetrant unilateral complex hindlimb duplication phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T C 10: 100,615,296 probably benign Het
4932414N04Rik T C 2: 68,664,403 probably null Het
Akr1c18 C T 13: 4,135,285 V283I probably benign Het
Atp2b2 T A 6: 113,760,831 M861L possibly damaging Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Clspn A G 4: 126,576,379 E814G probably damaging Het
Csgalnact1 T C 8: 68,461,262 Q97R probably benign Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Ect2 A T 3: 27,130,120 D517E probably benign Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat2 T C 11: 55,296,382 T1213A probably benign Het
Fkbp8 T A 8: 70,532,661 L275Q probably damaging Het
Gabrb2 A G 11: 42,626,881 Y510C probably damaging Het
Gda T C 19: 21,472,445 T16A probably benign Het
Ggcx G A 6: 72,426,558 G363R probably benign Het
Gm527 T G 12: 64,923,502 probably benign Het
Hoxb2 A G 11: 96,353,175 E204G probably damaging Het
Hsd17b11 G A 5: 103,992,937 probably benign Het
Kat14 T C 2: 144,407,329 probably benign Het
Kif16b C T 2: 142,707,359 V1079I probably benign Het
Klhl29 T A 12: 5,140,660 S112C probably damaging Het
Lpcat2 G T 8: 92,864,903 M58I probably benign Het
Lrrc8d G T 5: 105,814,276 V851F probably benign Het
Ltbp3 T C 19: 5,756,001 V929A probably damaging Het
Map3k9 T C 12: 81,722,521 M941V probably benign Het
Myom2 A T 8: 15,084,556 Y453F probably benign Het
Ncapd2 T C 6: 125,186,784 K78E probably damaging Het
Ncor2 G T 5: 125,032,256 D1496E possibly damaging Het
Ndnf T C 6: 65,703,141 Y135H possibly damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Nmur2 G C 11: 56,040,225 P220R probably damaging Het
Nsd1 G C 13: 55,268,454 E1438Q probably benign Het
Olfr1043 G T 2: 86,162,618 C110* probably null Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Olfr1413 T A 1: 92,573,789 M206K possibly damaging Het
Olfr229 A T 9: 39,910,725 R307S probably benign Het
Pom121l2 T G 13: 21,982,128 S190A probably damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Scarb1 A C 5: 125,287,411 C85G probably damaging Het
Sh2d4b A G 14: 40,872,546 I159T probably damaging Het
Sntg1 C T 1: 8,782,901 probably benign Het
Sos1 G A 17: 80,424,181 T630I probably damaging Het
Spata7 T A 12: 98,669,473 D517E probably damaging Het
Tcaf1 T C 6: 42,679,059 T328A probably benign Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Trpc2 T A 7: 102,093,574 M597K probably damaging Het
Ttc37 T G 13: 76,130,219 L551V probably damaging Het
Tubb3 C A 8: 123,421,264 T312N probably damaging Het
Ubr4 G A 4: 139,393,094 V277M probably damaging Het
Uhrf2 G A 19: 30,079,861 R473Q probably damaging Het
Vmn2r43 T A 7: 8,255,320 H298L probably benign Het
Other mutations in Map3k20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Map3k20 APN 2 72412170 missense probably damaging 1.00
IGL00333:Map3k20 APN 2 72371976 missense probably damaging 0.99
IGL00505:Map3k20 APN 2 72389483 missense probably damaging 1.00
IGL01472:Map3k20 APN 2 72355553 splice site probably benign
IGL01982:Map3k20 APN 2 72298333 nonsense probably null
IGL02556:Map3k20 APN 2 72371895 missense probably damaging 0.98
IGL02831:Map3k20 APN 2 72371727 missense probably damaging 1.00
3-1:Map3k20 UTSW 2 72412125 missense probably damaging 1.00
R0765:Map3k20 UTSW 2 72371925 missense probably damaging 1.00
R1160:Map3k20 UTSW 2 72441520 missense probably benign 0.01
R1195:Map3k20 UTSW 2 72438218 missense probably damaging 1.00
R1195:Map3k20 UTSW 2 72438218 missense probably damaging 1.00
R1195:Map3k20 UTSW 2 72438218 missense probably damaging 1.00
R1406:Map3k20 UTSW 2 72389494 missense probably damaging 0.99
R1406:Map3k20 UTSW 2 72389494 missense probably damaging 0.99
R1509:Map3k20 UTSW 2 72364624 splice site probably benign
R1634:Map3k20 UTSW 2 72410177 nonsense probably null
R1723:Map3k20 UTSW 2 72389492 missense probably damaging 1.00
R1986:Map3k20 UTSW 2 72441294 nonsense probably null
R2014:Map3k20 UTSW 2 72438260 missense probably benign 0.00
R2086:Map3k20 UTSW 2 72398385 missense probably benign 0.01
R2311:Map3k20 UTSW 2 72368440 missense probably damaging 1.00
R2655:Map3k20 UTSW 2 72433420 missense probably damaging 1.00
R3150:Map3k20 UTSW 2 72371992 missense probably damaging 1.00
R3781:Map3k20 UTSW 2 72402355 intron probably benign
R3950:Map3k20 UTSW 2 72438300 missense probably damaging 0.99
R3952:Map3k20 UTSW 2 72438300 missense probably damaging 0.99
R3981:Map3k20 UTSW 2 72438227 missense probably damaging 0.99
R3982:Map3k20 UTSW 2 72438227 missense probably damaging 0.99
R3983:Map3k20 UTSW 2 72438227 missense probably damaging 0.99
R4011:Map3k20 UTSW 2 72384124 splice site probably benign
R4180:Map3k20 UTSW 2 72441571 missense probably damaging 0.97
R4790:Map3k20 UTSW 2 72441704 missense probably benign
R4895:Map3k20 UTSW 2 72402356 intron probably benign
R4943:Map3k20 UTSW 2 72371918 missense possibly damaging 0.90
R4983:Map3k20 UTSW 2 72402067 missense probably benign 0.00
R5023:Map3k20 UTSW 2 72402345 intron probably benign
R5157:Map3k20 UTSW 2 72438214 missense probably benign 0.00
R5703:Map3k20 UTSW 2 72402170 missense probably benign 0.00
R6134:Map3k20 UTSW 2 72410159 missense probably damaging 0.99
R6322:Map3k20 UTSW 2 72433470 missense possibly damaging 0.95
R6418:Map3k20 UTSW 2 72402113 missense probably benign 0.15
R6449:Map3k20 UTSW 2 72398414 missense probably damaging 1.00
R6495:Map3k20 UTSW 2 72368419 missense probably damaging 1.00
R6508:Map3k20 UTSW 2 72441909 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CACTGAATCCATTATGAGAAAGGGG -3'
(R):5'- AGGCCTCATTGCTGGTTCTC -3'

Sequencing Primer
(F):5'- GGAGTGTTCCTCTTATTCAAATTCAC -3'
(R):5'- CATTGCTGGTTCTCAGGTCTCAAG -3'
Posted On2015-04-17