Incidental Mutation 'R3951:Olfr1043'
ID307919
Institutional Source Beutler Lab
Gene Symbol Olfr1043
Ensembl Gene ENSMUSG00000075201
Gene Nameolfactory receptor 1043
SynonymsMOR185-7, GA_x6K02T2Q125-47631900-47630956
MMRRC Submission 040828-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R3951 (G1)
Quality Score93
Status Validated
Chromosome2
Chromosomal Location86161890-86167522 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 86162618 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 110 (C110*)
Ref Sequence ENSEMBL: ENSMUSP00000149716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099907] [ENSMUST00000099908] [ENSMUST00000213886] [ENSMUST00000213949] [ENSMUST00000215624] [ENSMUST00000216028]
Predicted Effect probably null
Transcript: ENSMUST00000099907
AA Change: C110*
SMART Domains Protein: ENSMUSP00000097491
Gene: ENSMUSG00000075201
AA Change: C110*

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 6.9e-46 PFAM
Pfam:7tm_1 41 290 1.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099908
SMART Domains Protein: ENSMUSP00000097492
Gene: ENSMUSG00000075202

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.2e-48 PFAM
Pfam:7tm_1 41 290 1.3e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213886
AA Change: C110*
Predicted Effect probably null
Transcript: ENSMUST00000213949
AA Change: C110*
Predicted Effect probably benign
Transcript: ENSMUST00000215624
Predicted Effect probably null
Transcript: ENSMUST00000216028
AA Change: C110*
Meta Mutation Damage Score 0.6428 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T C 10: 100,615,296 probably benign Het
4932414N04Rik T C 2: 68,664,403 probably null Het
Akr1c18 C T 13: 4,135,285 V283I probably benign Het
Atp2b2 T A 6: 113,760,831 M861L possibly damaging Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Clspn A G 4: 126,576,379 E814G probably damaging Het
Csgalnact1 T C 8: 68,461,262 Q97R probably benign Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Ect2 A T 3: 27,130,120 D517E probably benign Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat2 T C 11: 55,296,382 T1213A probably benign Het
Fkbp8 T A 8: 70,532,661 L275Q probably damaging Het
Gabrb2 A G 11: 42,626,881 Y510C probably damaging Het
Gda T C 19: 21,472,445 T16A probably benign Het
Ggcx G A 6: 72,426,558 G363R probably benign Het
Gm527 T G 12: 64,923,502 probably benign Het
Hoxb2 A G 11: 96,353,175 E204G probably damaging Het
Hsd17b11 G A 5: 103,992,937 probably benign Het
Kat14 T C 2: 144,407,329 probably benign Het
Kif16b C T 2: 142,707,359 V1079I probably benign Het
Klhl29 T A 12: 5,140,660 S112C probably damaging Het
Lpcat2 G T 8: 92,864,903 M58I probably benign Het
Lrrc8d G T 5: 105,814,276 V851F probably benign Het
Ltbp3 T C 19: 5,756,001 V929A probably damaging Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Map3k9 T C 12: 81,722,521 M941V probably benign Het
Myom2 A T 8: 15,084,556 Y453F probably benign Het
Ncapd2 T C 6: 125,186,784 K78E probably damaging Het
Ncor2 G T 5: 125,032,256 D1496E possibly damaging Het
Ndnf T C 6: 65,703,141 Y135H possibly damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Nmur2 G C 11: 56,040,225 P220R probably damaging Het
Nsd1 G C 13: 55,268,454 E1438Q probably benign Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Olfr1413 T A 1: 92,573,789 M206K possibly damaging Het
Olfr229 A T 9: 39,910,725 R307S probably benign Het
Pom121l2 T G 13: 21,982,128 S190A probably damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Scarb1 A C 5: 125,287,411 C85G probably damaging Het
Sh2d4b A G 14: 40,872,546 I159T probably damaging Het
Sntg1 C T 1: 8,782,901 probably benign Het
Sos1 G A 17: 80,424,181 T630I probably damaging Het
Spata7 T A 12: 98,669,473 D517E probably damaging Het
Tcaf1 T C 6: 42,679,059 T328A probably benign Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Trpc2 T A 7: 102,093,574 M597K probably damaging Het
Ttc37 T G 13: 76,130,219 L551V probably damaging Het
Tubb3 C A 8: 123,421,264 T312N probably damaging Het
Ubr4 G A 4: 139,393,094 V277M probably damaging Het
Uhrf2 G A 19: 30,079,861 R473Q probably damaging Het
Vmn2r43 T A 7: 8,255,320 H298L probably benign Het
Other mutations in Olfr1043
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Olfr1043 APN 2 86162920 missense probably benign 0.01
IGL02037:Olfr1043 APN 2 86162837 missense probably benign
IGL02174:Olfr1043 APN 2 86162098 missense possibly damaging 0.78
IGL02511:Olfr1043 APN 2 86162019 missense probably benign 0.00
IGL02578:Olfr1043 APN 2 86162729 nonsense probably null
IGL03084:Olfr1043 APN 2 86162225 nonsense probably null
R0278:Olfr1043 UTSW 2 86162579 nonsense probably null
R0633:Olfr1043 UTSW 2 86162091 missense probably damaging 1.00
R0972:Olfr1043 UTSW 2 86162304 missense possibly damaging 0.94
R1033:Olfr1043 UTSW 2 86162850 missense possibly damaging 0.67
R2116:Olfr1043 UTSW 2 86162729 nonsense probably null
R2998:Olfr1043 UTSW 2 86162020 missense probably benign
R5147:Olfr1043 UTSW 2 86162034 missense possibly damaging 0.79
R6193:Olfr1043 UTSW 2 86162284 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGGTTCACTAGGTTGGAGTCAC -3'
(R):5'- AACCTAGGGTTGGTTGTGTTAATAC -3'

Sequencing Primer
(F):5'- TTCACTAGGTTGGAGTCACAAAAAG -3'
(R):5'- GGTTGTGTTAATACAAATCAGCCCAC -3'
Posted On2015-04-17