Incidental Mutation 'R3951:Ect2'
ID307922
Institutional Source Beutler Lab
Gene Symbol Ect2
Ensembl Gene ENSMUSG00000027699
Gene Nameect2 oncogene
Synonyms
MMRRC Submission 040828-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3951 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location27097222-27153878 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27130120 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 517 (D517E)
Ref Sequence ENSEMBL: ENSMUSP00000103935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108298] [ENSMUST00000108300] [ENSMUST00000176242] [ENSMUST00000184113]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108296
Predicted Effect probably benign
Transcript: ENSMUST00000108298
AA Change: D486E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103933
Gene: ENSMUSG00000027699
AA Change: D486E

DomainStartEndE-ValueType
BRCT 143 219 1.45e-10 SMART
BRCT 237 313 2.52e-10 SMART
low complexity region 331 341 N/A INTRINSIC
RhoGEF 425 609 3.22e-67 SMART
Blast:PH 636 763 9e-81 BLAST
low complexity region 825 839 N/A INTRINSIC
low complexity region 856 865 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108300
AA Change: D517E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000103935
Gene: ENSMUSG00000027699
AA Change: D517E

DomainStartEndE-ValueType
BRCT 174 250 1.45e-10 SMART
BRCT 268 344 2.52e-10 SMART
low complexity region 362 372 N/A INTRINSIC
RhoGEF 456 640 3.22e-67 SMART
Blast:PH 667 794 1e-80 BLAST
low complexity region 856 870 N/A INTRINSIC
low complexity region 887 896 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124727
Predicted Effect probably benign
Transcript: ENSMUST00000176242
AA Change: D486E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135740
Gene: ENSMUSG00000027699
AA Change: D486E

DomainStartEndE-ValueType
BRCT 143 219 1.45e-10 SMART
BRCT 237 313 2.52e-10 SMART
low complexity region 331 341 N/A INTRINSIC
RhoGEF 425 609 3.22e-67 SMART
Blast:PH 636 763 9e-81 BLAST
low complexity region 825 839 N/A INTRINSIC
low complexity region 856 865 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184113
Meta Mutation Damage Score 0.188 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor and transforming protein that is related to Rho-specific exchange factors and yeast cell cycle regulators. The expression of this gene is elevated with the onset of DNA synthesis and remains elevated during G2 and M phases. In situ hybridization analysis showed that expression is at a high level in cells undergoing mitosis in regenerating liver. Thus, this protein is expressed in a cell cycle-dependent manner during liver regeneration, and is thought to have an important role in the regulation of cytokinesis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2017]
PHENOTYPE: Homozygous disruption of this locus is embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T C 10: 100,615,296 probably benign Het
4932414N04Rik T C 2: 68,664,403 probably null Het
Akr1c18 C T 13: 4,135,285 V283I probably benign Het
Atp2b2 T A 6: 113,760,831 M861L possibly damaging Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Clspn A G 4: 126,576,379 E814G probably damaging Het
Csgalnact1 T C 8: 68,461,262 Q97R probably benign Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat2 T C 11: 55,296,382 T1213A probably benign Het
Fkbp8 T A 8: 70,532,661 L275Q probably damaging Het
Gabrb2 A G 11: 42,626,881 Y510C probably damaging Het
Gda T C 19: 21,472,445 T16A probably benign Het
Ggcx G A 6: 72,426,558 G363R probably benign Het
Gm527 T G 12: 64,923,502 probably benign Het
Hoxb2 A G 11: 96,353,175 E204G probably damaging Het
Hsd17b11 G A 5: 103,992,937 probably benign Het
Kat14 T C 2: 144,407,329 probably benign Het
Kif16b C T 2: 142,707,359 V1079I probably benign Het
Klhl29 T A 12: 5,140,660 S112C probably damaging Het
Lpcat2 G T 8: 92,864,903 M58I probably benign Het
Lrrc8d G T 5: 105,814,276 V851F probably benign Het
Ltbp3 T C 19: 5,756,001 V929A probably damaging Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Map3k9 T C 12: 81,722,521 M941V probably benign Het
Myom2 A T 8: 15,084,556 Y453F probably benign Het
Ncapd2 T C 6: 125,186,784 K78E probably damaging Het
Ncor2 G T 5: 125,032,256 D1496E possibly damaging Het
Ndnf T C 6: 65,703,141 Y135H possibly damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Nmur2 G C 11: 56,040,225 P220R probably damaging Het
Nsd1 G C 13: 55,268,454 E1438Q probably benign Het
Olfr1043 G T 2: 86,162,618 C110* probably null Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Olfr1413 T A 1: 92,573,789 M206K possibly damaging Het
Olfr229 A T 9: 39,910,725 R307S probably benign Het
Pom121l2 T G 13: 21,982,128 S190A probably damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Scarb1 A C 5: 125,287,411 C85G probably damaging Het
Sh2d4b A G 14: 40,872,546 I159T probably damaging Het
Sntg1 C T 1: 8,782,901 probably benign Het
Sos1 G A 17: 80,424,181 T630I probably damaging Het
Spata7 T A 12: 98,669,473 D517E probably damaging Het
Tcaf1 T C 6: 42,679,059 T328A probably benign Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Trpc2 T A 7: 102,093,574 M597K probably damaging Het
Ttc37 T G 13: 76,130,219 L551V probably damaging Het
Tubb3 C A 8: 123,421,264 T312N probably damaging Het
Ubr4 G A 4: 139,393,094 V277M probably damaging Het
Uhrf2 G A 19: 30,079,861 R473Q probably damaging Het
Vmn2r43 T A 7: 8,255,320 H298L probably benign Het
Other mutations in Ect2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Ect2 APN 3 27138669 missense probably benign 0.04
IGL00770:Ect2 APN 3 27098443 missense probably damaging 0.99
IGL00774:Ect2 APN 3 27098443 missense probably damaging 0.99
IGL01414:Ect2 APN 3 27127729 splice site probably benign
IGL02017:Ect2 APN 3 27122044 nonsense probably null
IGL02318:Ect2 APN 3 27138719 missense probably benign 0.16
IGL02395:Ect2 APN 3 27150106 missense probably damaging 1.00
IGL03109:Ect2 APN 3 27144972 missense possibly damaging 0.88
IGL03178:Ect2 APN 3 27148860 missense probably benign 0.03
IGL03055:Ect2 UTSW 3 27137062 missense probably damaging 1.00
R0090:Ect2 UTSW 3 27115476 missense probably benign 0.00
R0090:Ect2 UTSW 3 27138502 missense probably null 0.08
R0436:Ect2 UTSW 3 27150095 missense probably benign 0.11
R0620:Ect2 UTSW 3 27139652 missense probably damaging 0.99
R1847:Ect2 UTSW 3 27150072 missense probably benign 0.01
R2404:Ect2 UTSW 3 27131850 missense probably benign 0.00
R3890:Ect2 UTSW 3 27138540 missense probably damaging 1.00
R4588:Ect2 UTSW 3 27147000 missense probably damaging 1.00
R4754:Ect2 UTSW 3 27126963 missense probably damaging 1.00
R5051:Ect2 UTSW 3 27102486 missense probably benign
R5254:Ect2 UTSW 3 27130070 missense probably damaging 1.00
R5415:Ect2 UTSW 3 27146853 missense probably damaging 1.00
R5786:Ect2 UTSW 3 27146953 missense probably damaging 1.00
R5940:Ect2 UTSW 3 27115465 missense probably benign 0.01
R5974:Ect2 UTSW 3 27144963 nonsense probably null
R6012:Ect2 UTSW 3 27098325 utr 3 prime probably benign
R6434:Ect2 UTSW 3 27139119 nonsense probably null
R6447:Ect2 UTSW 3 27115484 missense probably damaging 1.00
R6850:Ect2 UTSW 3 27138885 missense probably damaging 1.00
R6989:Ect2 UTSW 3 27102488 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTAGCAGATTTTAAAACCATGGG -3'
(R):5'- TCATATAGGGGAATTAGGATTGGTC -3'

Sequencing Primer
(F):5'- GGGAAATGGCATTTTCACATTTCC -3'
(R):5'- TCCCAGCAGAAGATCTCA -3'
Posted On2015-04-17