Incidental Mutation 'R3951:Ticrr'
ID307939
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene NameTOPBP1-interacting checkpoint and replication regulator
Synonyms5730590G19Rik
MMRRC Submission 040828-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R3951 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location79660196-79698148 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79682069 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 776 (L776S)
Ref Sequence ENSEMBL: ENSMUSP00000145735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]
Predicted Effect probably damaging
Transcript: ENSMUST00000035977
AA Change: L776S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: L776S

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206017
Predicted Effect probably damaging
Transcript: ENSMUST00000206591
AA Change: L776S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000206622
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T C 10: 100,615,296 probably benign Het
4932414N04Rik T C 2: 68,664,403 probably null Het
Akr1c18 C T 13: 4,135,285 V283I probably benign Het
Atp2b2 T A 6: 113,760,831 M861L possibly damaging Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Clspn A G 4: 126,576,379 E814G probably damaging Het
Csgalnact1 T C 8: 68,461,262 Q97R probably benign Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Ect2 A T 3: 27,130,120 D517E probably benign Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat2 T C 11: 55,296,382 T1213A probably benign Het
Fkbp8 T A 8: 70,532,661 L275Q probably damaging Het
Gabrb2 A G 11: 42,626,881 Y510C probably damaging Het
Gda T C 19: 21,472,445 T16A probably benign Het
Ggcx G A 6: 72,426,558 G363R probably benign Het
Gm527 T G 12: 64,923,502 probably benign Het
Hoxb2 A G 11: 96,353,175 E204G probably damaging Het
Hsd17b11 G A 5: 103,992,937 probably benign Het
Kat14 T C 2: 144,407,329 probably benign Het
Kif16b C T 2: 142,707,359 V1079I probably benign Het
Klhl29 T A 12: 5,140,660 S112C probably damaging Het
Lpcat2 G T 8: 92,864,903 M58I probably benign Het
Lrrc8d G T 5: 105,814,276 V851F probably benign Het
Ltbp3 T C 19: 5,756,001 V929A probably damaging Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Map3k9 T C 12: 81,722,521 M941V probably benign Het
Myom2 A T 8: 15,084,556 Y453F probably benign Het
Ncapd2 T C 6: 125,186,784 K78E probably damaging Het
Ncor2 G T 5: 125,032,256 D1496E possibly damaging Het
Ndnf T C 6: 65,703,141 Y135H possibly damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Nmur2 G C 11: 56,040,225 P220R probably damaging Het
Nsd1 G C 13: 55,268,454 E1438Q probably benign Het
Olfr1043 G T 2: 86,162,618 C110* probably null Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Olfr1413 T A 1: 92,573,789 M206K possibly damaging Het
Olfr229 A T 9: 39,910,725 R307S probably benign Het
Pom121l2 T G 13: 21,982,128 S190A probably damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Scarb1 A C 5: 125,287,411 C85G probably damaging Het
Sh2d4b A G 14: 40,872,546 I159T probably damaging Het
Sntg1 C T 1: 8,782,901 probably benign Het
Sos1 G A 17: 80,424,181 T630I probably damaging Het
Spata7 T A 12: 98,669,473 D517E probably damaging Het
Tcaf1 T C 6: 42,679,059 T328A probably benign Het
Trpc2 T A 7: 102,093,574 M597K probably damaging Het
Ttc37 T G 13: 76,130,219 L551V probably damaging Het
Tubb3 C A 8: 123,421,264 T312N probably damaging Het
Ubr4 G A 4: 139,393,094 V277M probably damaging Het
Uhrf2 G A 19: 30,079,861 R473Q probably damaging Het
Vmn2r43 T A 7: 8,255,320 H298L probably benign Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79677283 missense probably damaging 1.00
IGL00596:Ticrr APN 7 79677293 missense probably damaging 1.00
IGL01327:Ticrr APN 7 79694461 missense probably benign 0.00
IGL01525:Ticrr APN 7 79682449 missense probably damaging 1.00
IGL01565:Ticrr APN 7 79694548 missense probably benign
IGL01936:Ticrr APN 7 79694549 missense probably benign 0.11
IGL02160:Ticrr APN 7 79694019 missense probably benign 0.29
IGL02246:Ticrr APN 7 79675328 missense probably damaging 1.00
IGL02487:Ticrr APN 7 79683021 missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79695466 missense probably damaging 0.99
IGL02970:Ticrr APN 7 79695171 missense probably benign 0.01
FR4304:Ticrr UTSW 7 79694311 intron probably benign
R0016:Ticrr UTSW 7 79693792 missense probably benign 0.01
R0062:Ticrr UTSW 7 79667906 missense probably benign 0.01
R0062:Ticrr UTSW 7 79667906 missense probably benign 0.01
R0067:Ticrr UTSW 7 79677410 missense probably damaging 1.00
R0067:Ticrr UTSW 7 79677410 missense probably damaging 1.00
R0362:Ticrr UTSW 7 79677340 missense probably damaging 1.00
R0482:Ticrr UTSW 7 79694488 missense probably damaging 0.99
R0595:Ticrr UTSW 7 79695563 missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1119:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1572:Ticrr UTSW 7 79681824 missense probably damaging 1.00
R1658:Ticrr UTSW 7 79695549 missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79675323 missense probably damaging 0.99
R1757:Ticrr UTSW 7 79679046 nonsense probably null
R1862:Ticrr UTSW 7 79695207 missense probably damaging 1.00
R1869:Ticrr UTSW 7 79679135 missense probably damaging 1.00
R1938:Ticrr UTSW 7 79675394 missense probably damaging 0.98
R1966:Ticrr UTSW 7 79694735 nonsense probably null
R2006:Ticrr UTSW 7 79694073 missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79665685 missense probably benign 0.12
R3404:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3405:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3941:Ticrr UTSW 7 79693697 intron probably benign
R3950:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R3952:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R4967:Ticrr UTSW 7 79660410 missense probably damaging 0.99
R4972:Ticrr UTSW 7 79669668 missense probably damaging 0.98
R5259:Ticrr UTSW 7 79694723 missense probably benign 0.01
R5272:Ticrr UTSW 7 79669605 missense probably benign 0.44
R5374:Ticrr UTSW 7 79690942 nonsense probably null
R5480:Ticrr UTSW 7 79660809 missense probably damaging 1.00
R5568:Ticrr UTSW 7 79689967 critical splice donor site probably null
R5568:Ticrr UTSW 7 79695296 nonsense probably null
R5588:Ticrr UTSW 7 79679105 missense probably damaging 1.00
R5698:Ticrr UTSW 7 79679133 missense probably benign
R5879:Ticrr UTSW 7 79696690 missense probably benign 0.12
R5980:Ticrr UTSW 7 79660955 missense probably damaging 0.99
R6128:Ticrr UTSW 7 79693968 missense probably damaging 1.00
R6277:Ticrr UTSW 7 79694696 missense probably benign 0.00
R6335:Ticrr UTSW 7 79694283 unclassified probably null
R6866:Ticrr UTSW 7 79693957 missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79665850 missense probably benign 0.00
R6923:Ticrr UTSW 7 79691853 missense probably damaging 0.98
R6962:Ticrr UTSW 7 79665897 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GGTGCCAGCTTCAGGTATTTC -3'
(R):5'- GGGGATGGAGCCAATATACCTG -3'

Sequencing Primer
(F):5'- AGATGTGTGAGCAGTGCCC -3'
(R):5'- TGGAGCCAATATACCTGTGGAATG -3'
Posted On2015-04-17