Incidental Mutation 'R3951:Trpc2'
ID307940
Institutional Source Beutler Lab
Gene Symbol Trpc2
Ensembl Gene ENSMUSG00000100254
Gene Nametransient receptor potential cation channel, subfamily C, member 2
Synonymstrp2, mTrp2, TRPC2a, TRPC2b, 3010009O07Rik, Trrp2
MMRRC Submission 040828-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R3951 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102083116-102096396 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102093574 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 597 (M597K)
Ref Sequence ENSEMBL: ENSMUSP00000116934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084843] [ENSMUST00000094128] [ENSMUST00000094129] [ENSMUST00000106934] [ENSMUST00000106935] [ENSMUST00000106937] [ENSMUST00000123372] [ENSMUST00000124189] [ENSMUST00000139104]
Predicted Effect unknown
Transcript: ENSMUST00000084843
AA Change: M971K
SMART Domains Protein: ENSMUSP00000081903
Gene: ENSMUSG00000070425
AA Change: M971K

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 150 1.4e-54 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
low complexity region 345 362 N/A INTRINSIC
low complexity region 403 415 N/A INTRINSIC
low complexity region 416 428 N/A INTRINSIC
ANK 439 469 1.58e3 SMART
low complexity region 484 496 N/A INTRINSIC
ANK 522 551 1.74e0 SMART
Pfam:TRP_2 557 619 1e-24 PFAM
Pfam:Ion_trans 716 1024 1.7e-24 PFAM
Pfam:PKD_channel 774 1019 2.4e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
coiled coil region 1122 1162 N/A INTRINSIC
low complexity region 1220 1236 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094128
SMART Domains Protein: ENSMUSP00000091678
Gene: ENSMUSG00000070424

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 255 3.6e-96 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000094129
AA Change: M971K
SMART Domains Protein: ENSMUSP00000091679
Gene: ENSMUSG00000070425
AA Change: M971K

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 152 1.2e-27 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
low complexity region 345 362 N/A INTRINSIC
low complexity region 403 415 N/A INTRINSIC
low complexity region 416 428 N/A INTRINSIC
ANK 439 469 1.58e3 SMART
low complexity region 484 496 N/A INTRINSIC
ANK 522 551 1.74e0 SMART
Pfam:TRP_2 557 619 2.8e-28 PFAM
transmembrane domain 719 741 N/A INTRINSIC
Pfam:PKD_channel 772 1019 3.8e-12 PFAM
Pfam:Ion_trans 796 1012 3.9e-31 PFAM
low complexity region 1070 1081 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
coiled coil region 1122 1162 N/A INTRINSIC
low complexity region 1220 1236 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106934
SMART Domains Protein: ENSMUSP00000102547
Gene: ENSMUSG00000070424

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 117 3.7e-29 PFAM
Pfam:ART 114 157 6.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106935
SMART Domains Protein: ENSMUSP00000102548
Gene: ENSMUSG00000070424

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 146 2.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106937
SMART Domains Protein: ENSMUSP00000102550
Gene: ENSMUSG00000070424

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 255 1.9e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123372
SMART Domains Protein: ENSMUSP00000121068
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 152 5.2e-29 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
internal_repeat_1 324 345 2.69e-6 PROSPERO
low complexity region 346 379 N/A INTRINSIC
internal_repeat_1 380 401 2.69e-6 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000124189
AA Change: M597K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116934
Gene: ENSMUSG00000100254
AA Change: M597K

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
low complexity region 42 54 N/A INTRINSIC
ANK 65 95 1.58e3 SMART
low complexity region 110 122 N/A INTRINSIC
ANK 148 177 1.74e0 SMART
Pfam:TRP_2 183 245 9.1e-29 PFAM
transmembrane domain 345 367 N/A INTRINSIC
Pfam:PKD_channel 398 645 1.4e-12 PFAM
Pfam:Ion_trans 422 638 1e-31 PFAM
low complexity region 696 707 N/A INTRINSIC
low complexity region 719 730 N/A INTRINSIC
coiled coil region 748 788 N/A INTRINSIC
low complexity region 846 862 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139104
SMART Domains Protein: ENSMUSP00000122430
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 62 3.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155078
SMART Domains Protein: ENSMUSP00000123466
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 62 4.4e-22 PFAM
Meta Mutation Damage Score 0.0724 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (55/55)
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit altered sexual and social behavior, including intermale mounting and a lack of aggressive behavior in the presence of invading males. Homozygotes for another allele show increased triglyceride levels in both males and femalesand increased cholesterol in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T C 10: 100,615,296 probably benign Het
4932414N04Rik T C 2: 68,664,403 probably null Het
Akr1c18 C T 13: 4,135,285 V283I probably benign Het
Atp2b2 T A 6: 113,760,831 M861L possibly damaging Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Clspn A G 4: 126,576,379 E814G probably damaging Het
Csgalnact1 T C 8: 68,461,262 Q97R probably benign Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Ect2 A T 3: 27,130,120 D517E probably benign Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat2 T C 11: 55,296,382 T1213A probably benign Het
Fkbp8 T A 8: 70,532,661 L275Q probably damaging Het
Gabrb2 A G 11: 42,626,881 Y510C probably damaging Het
Gda T C 19: 21,472,445 T16A probably benign Het
Ggcx G A 6: 72,426,558 G363R probably benign Het
Gm527 T G 12: 64,923,502 probably benign Het
Hoxb2 A G 11: 96,353,175 E204G probably damaging Het
Hsd17b11 G A 5: 103,992,937 probably benign Het
Kat14 T C 2: 144,407,329 probably benign Het
Kif16b C T 2: 142,707,359 V1079I probably benign Het
Klhl29 T A 12: 5,140,660 S112C probably damaging Het
Lpcat2 G T 8: 92,864,903 M58I probably benign Het
Lrrc8d G T 5: 105,814,276 V851F probably benign Het
Ltbp3 T C 19: 5,756,001 V929A probably damaging Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Map3k9 T C 12: 81,722,521 M941V probably benign Het
Myom2 A T 8: 15,084,556 Y453F probably benign Het
Ncapd2 T C 6: 125,186,784 K78E probably damaging Het
Ncor2 G T 5: 125,032,256 D1496E possibly damaging Het
Ndnf T C 6: 65,703,141 Y135H possibly damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Nmur2 G C 11: 56,040,225 P220R probably damaging Het
Nsd1 G C 13: 55,268,454 E1438Q probably benign Het
Olfr1043 G T 2: 86,162,618 C110* probably null Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Olfr1413 T A 1: 92,573,789 M206K possibly damaging Het
Olfr229 A T 9: 39,910,725 R307S probably benign Het
Pom121l2 T G 13: 21,982,128 S190A probably damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Scarb1 A C 5: 125,287,411 C85G probably damaging Het
Sh2d4b A G 14: 40,872,546 I159T probably damaging Het
Sntg1 C T 1: 8,782,901 probably benign Het
Sos1 G A 17: 80,424,181 T630I probably damaging Het
Spata7 T A 12: 98,669,473 D517E probably damaging Het
Tcaf1 T C 6: 42,679,059 T328A probably benign Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Ttc37 T G 13: 76,130,219 L551V probably damaging Het
Tubb3 C A 8: 123,421,264 T312N probably damaging Het
Ubr4 G A 4: 139,393,094 V277M probably damaging Het
Uhrf2 G A 19: 30,079,861 R473Q probably damaging Het
Vmn2r43 T A 7: 8,255,320 H298L probably benign Het
Other mutations in Trpc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0443:Trpc2 UTSW 7 102093520 splice site probably benign
R0601:Trpc2 UTSW 7 102084365 missense possibly damaging 0.53
R1303:Trpc2 UTSW 7 102088161 missense probably damaging 1.00
R1493:Trpc2 UTSW 7 102090576 missense probably damaging 0.97
R1579:Trpc2 UTSW 7 102084240 missense probably damaging 0.99
R1829:Trpc2 UTSW 7 102084119 missense probably damaging 1.00
R2010:Trpc2 UTSW 7 102094573 missense probably benign
R3103:Trpc2 UTSW 7 102095234 missense possibly damaging 0.74
R3738:Trpc2 UTSW 7 102084504 missense probably damaging 1.00
R3739:Trpc2 UTSW 7 102084504 missense probably damaging 1.00
R3938:Trpc2 UTSW 7 102093574 missense probably damaging 1.00
R3945:Trpc2 UTSW 7 102088279 missense possibly damaging 0.52
R3970:Trpc2 UTSW 7 102084324 missense probably damaging 1.00
R4035:Trpc2 UTSW 7 102084504 missense probably damaging 1.00
R4234:Trpc2 UTSW 7 102088135 missense possibly damaging 0.52
R4329:Trpc2 UTSW 7 102087520 missense probably damaging 1.00
R4531:Trpc2 UTSW 7 102095998 missense probably damaging 1.00
R4857:Trpc2 UTSW 7 102083969 missense probably benign 0.18
R5058:Trpc2 UTSW 7 102089109 missense probably damaging 1.00
R5093:Trpc2 UTSW 7 102095183 missense probably benign
R5485:Trpc2 UTSW 7 102095213 frame shift probably null
R5486:Trpc2 UTSW 7 102095213 frame shift probably null
R5487:Trpc2 UTSW 7 102095213 frame shift probably null
R5782:Trpc2 UTSW 7 102083979 missense possibly damaging 0.85
R6379:Trpc2 UTSW 7 102096091 nonsense probably null
R6572:Trpc2 UTSW 7 102090006 missense probably damaging 1.00
R6674:Trpc2 UTSW 7 102096057 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- GGCTTCATGGACATAGAACACC -3'
(R):5'- AACCCTTGTTGTACAGAGGAG -3'

Sequencing Primer
(F):5'- CATGGACATAGAACACCTTTGGCTG -3'
(R):5'- ACCCTTGTTGTACAGAGGAGAATTTG -3'
Posted On2015-04-17