Incidental Mutation 'R3951:Fkbp8'
ID307944
Institutional Source Beutler Lab
Gene Symbol Fkbp8
Ensembl Gene ENSMUSG00000019428
Gene NameFK506 binding protein 8
Synonyms38kDa, Fkbp38
MMRRC Submission 040828-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3951 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location70527724-70535328 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70532661 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 275 (L275Q)
Ref Sequence ENSEMBL: ENSMUSP00000112527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075491] [ENSMUST00000117580] [ENSMUST00000119353] [ENSMUST00000119425] [ENSMUST00000119698] [ENSMUST00000132867] [ENSMUST00000134893] [ENSMUST00000138260]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075491
AA Change: L276Q

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074935
Gene: ENSMUSG00000019428
AA Change: L276Q

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
Pfam:FKBP_C 103 192 1.4e-16 PFAM
Blast:TPR 212 245 2e-12 BLAST
low complexity region 253 259 N/A INTRINSIC
Pfam:TPR_1 263 296 5.4e-7 PFAM
Pfam:TPR_2 263 296 3.8e-5 PFAM
Pfam:TPR_16 267 331 3e-11 PFAM
Pfam:TPR_9 270 344 1.3e-7 PFAM
Pfam:TPR_19 273 340 1.6e-8 PFAM
Pfam:TPR_1 297 330 5.4e-8 PFAM
Pfam:TPR_2 297 330 1.3e-7 PFAM
Pfam:TPR_8 297 330 9e-7 PFAM
Pfam:TPR_14 297 340 2.1e-7 PFAM
transmembrane domain 381 400 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117580
SMART Domains Protein: ENSMUSP00000112561
Gene: ENSMUSG00000055553

DomainStartEndE-ValueType
Pfam:KxDL 12 99 5.1e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119353
AA Change: L275Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112527
Gene: ENSMUSG00000019428
AA Change: L275Q

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
Pfam:FKBP_C 103 191 1.3e-15 PFAM
Pfam:TPR_11 209 293 3.4e-9 PFAM
Pfam:TPR_1 262 295 6.5e-7 PFAM
Pfam:TPR_2 262 295 3.9e-5 PFAM
Pfam:TPR_16 266 330 1.4e-11 PFAM
Pfam:TPR_9 269 343 1.5e-7 PFAM
Pfam:TPR_19 272 339 8.6e-9 PFAM
Pfam:TPR_11 294 358 2.6e-9 PFAM
Pfam:TPR_1 296 329 6.6e-8 PFAM
Pfam:TPR_2 296 329 1.3e-7 PFAM
Pfam:TPR_8 296 330 5.5e-7 PFAM
transmembrane domain 380 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119425
SMART Domains Protein: ENSMUSP00000113528
Gene: ENSMUSG00000019428

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119698
AA Change: L276Q

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114069
Gene: ENSMUSG00000019428
AA Change: L276Q

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
Pfam:FKBP_C 103 192 6.4e-16 PFAM
Pfam:TPR_11 210 294 3.4e-9 PFAM
Pfam:TPR_1 263 296 6.5e-7 PFAM
Pfam:TPR_2 263 296 3.9e-5 PFAM
Pfam:TPR_16 267 331 1.4e-11 PFAM
Pfam:TPR_9 270 344 1.5e-7 PFAM
Pfam:TPR_19 273 340 8.6e-9 PFAM
Pfam:TPR_11 295 359 2.6e-9 PFAM
Pfam:TPR_1 297 330 6.6e-8 PFAM
Pfam:TPR_2 297 330 1.3e-7 PFAM
Pfam:TPR_8 297 331 5.6e-7 PFAM
transmembrane domain 381 400 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128513
Predicted Effect probably benign
Transcript: ENSMUST00000132867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134299
Predicted Effect probably benign
Transcript: ENSMUST00000134893
Predicted Effect probably benign
Transcript: ENSMUST00000138260
SMART Domains Protein: ENSMUSP00000123438
Gene: ENSMUSG00000055553

DomainStartEndE-ValueType
Pfam:KxDL 12 99 9.2e-40 PFAM
UBQ 105 176 2.14e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144766
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. Unlike the other members of the family, this encoded protein does not seem to have PPIase/rotamase activity. It may have a role in neurons associated with memory function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality, ventralization of neural cell fates, caudal neural tube dilation, and small eyes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T C 10: 100,615,296 probably benign Het
4932414N04Rik T C 2: 68,664,403 probably null Het
Akr1c18 C T 13: 4,135,285 V283I probably benign Het
Atp2b2 T A 6: 113,760,831 M861L possibly damaging Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Clspn A G 4: 126,576,379 E814G probably damaging Het
Csgalnact1 T C 8: 68,461,262 Q97R probably benign Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Ect2 A T 3: 27,130,120 D517E probably benign Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat2 T C 11: 55,296,382 T1213A probably benign Het
Gabrb2 A G 11: 42,626,881 Y510C probably damaging Het
Gda T C 19: 21,472,445 T16A probably benign Het
Ggcx G A 6: 72,426,558 G363R probably benign Het
Gm527 T G 12: 64,923,502 probably benign Het
Hoxb2 A G 11: 96,353,175 E204G probably damaging Het
Hsd17b11 G A 5: 103,992,937 probably benign Het
Kat14 T C 2: 144,407,329 probably benign Het
Kif16b C T 2: 142,707,359 V1079I probably benign Het
Klhl29 T A 12: 5,140,660 S112C probably damaging Het
Lpcat2 G T 8: 92,864,903 M58I probably benign Het
Lrrc8d G T 5: 105,814,276 V851F probably benign Het
Ltbp3 T C 19: 5,756,001 V929A probably damaging Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Map3k9 T C 12: 81,722,521 M941V probably benign Het
Myom2 A T 8: 15,084,556 Y453F probably benign Het
Ncapd2 T C 6: 125,186,784 K78E probably damaging Het
Ncor2 G T 5: 125,032,256 D1496E possibly damaging Het
Ndnf T C 6: 65,703,141 Y135H possibly damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Nmur2 G C 11: 56,040,225 P220R probably damaging Het
Nsd1 G C 13: 55,268,454 E1438Q probably benign Het
Olfr1043 G T 2: 86,162,618 C110* probably null Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Olfr1413 T A 1: 92,573,789 M206K possibly damaging Het
Olfr229 A T 9: 39,910,725 R307S probably benign Het
Pom121l2 T G 13: 21,982,128 S190A probably damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Scarb1 A C 5: 125,287,411 C85G probably damaging Het
Sh2d4b A G 14: 40,872,546 I159T probably damaging Het
Sntg1 C T 1: 8,782,901 probably benign Het
Sos1 G A 17: 80,424,181 T630I probably damaging Het
Spata7 T A 12: 98,669,473 D517E probably damaging Het
Tcaf1 T C 6: 42,679,059 T328A probably benign Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Trpc2 T A 7: 102,093,574 M597K probably damaging Het
Ttc37 T G 13: 76,130,219 L551V probably damaging Het
Tubb3 C A 8: 123,421,264 T312N probably damaging Het
Ubr4 G A 4: 139,393,094 V277M probably damaging Het
Uhrf2 G A 19: 30,079,861 R473Q probably damaging Het
Vmn2r43 T A 7: 8,255,320 H298L probably benign Het
Other mutations in Fkbp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Fkbp8 APN 8 70534561 missense probably damaging 1.00
IGL01832:Fkbp8 APN 8 70531545 missense probably benign 0.24
R0738:Fkbp8 UTSW 8 70529670 missense probably damaging 1.00
R1631:Fkbp8 UTSW 8 70531632 missense probably damaging 1.00
R1845:Fkbp8 UTSW 8 70531035 unclassified probably null
R3953:Fkbp8 UTSW 8 70534867 missense probably damaging 0.97
R3956:Fkbp8 UTSW 8 70534867 missense probably damaging 0.97
R3957:Fkbp8 UTSW 8 70534867 missense probably damaging 0.97
R4965:Fkbp8 UTSW 8 70531523 critical splice acceptor site probably null
R6655:Fkbp8 UTSW 8 70532670 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGACTTGGGTGGCCTCTTAG -3'
(R):5'- AATGGCTTAGGACTCCCAAGG -3'

Sequencing Primer
(F):5'- GGTGGCCTCTTAGGGGTC -3'
(R):5'- GATATGACAAAGCCAGTTTTCCCTC -3'
Posted On2015-04-17