Incidental Mutation 'R3951:Nmur2'
ID307954
Institutional Source Beutler Lab
Gene Symbol Nmur2
Ensembl Gene ENSMUSG00000037393
Gene Nameneuromedin U receptor 2
Synonyms
MMRRC Submission 040828-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R3951 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location56024987-56041010 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 56040225 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 220 (P220R)
Ref Sequence ENSEMBL: ENSMUSP00000044718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037682]
Predicted Effect probably damaging
Transcript: ENSMUST00000037682
AA Change: P220R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044718
Gene: ENSMUSG00000037393
AA Change: P220R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srw 42 337 4.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 48 334 1.8e-13 PFAM
Pfam:7tm_1 54 319 5.7e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134285
Meta Mutation Damage Score 0.352 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein from the G-protein coupled receptor 1 family. This protein is a receptor for neuromedin U, which is a neuropeptide that is widely distributed in the gut and central nervous system. This receptor plays an important role in the regulation of food intake and body weight. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit increased chemical and thermal nociception thresholds, insensitivity to treatment with Nmu or Nms, and altered weight gain following a fast or when fed a high-fat diet that can be sex-dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T C 10: 100,615,296 probably benign Het
4932414N04Rik T C 2: 68,664,403 probably null Het
Akr1c18 C T 13: 4,135,285 V283I probably benign Het
Atp2b2 T A 6: 113,760,831 M861L possibly damaging Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Clspn A G 4: 126,576,379 E814G probably damaging Het
Csgalnact1 T C 8: 68,461,262 Q97R probably benign Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Ect2 A T 3: 27,130,120 D517E probably benign Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat2 T C 11: 55,296,382 T1213A probably benign Het
Fkbp8 T A 8: 70,532,661 L275Q probably damaging Het
Gabrb2 A G 11: 42,626,881 Y510C probably damaging Het
Gda T C 19: 21,472,445 T16A probably benign Het
Ggcx G A 6: 72,426,558 G363R probably benign Het
Gm527 T G 12: 64,923,502 probably benign Het
Hoxb2 A G 11: 96,353,175 E204G probably damaging Het
Hsd17b11 G A 5: 103,992,937 probably benign Het
Kat14 T C 2: 144,407,329 probably benign Het
Kif16b C T 2: 142,707,359 V1079I probably benign Het
Klhl29 T A 12: 5,140,660 S112C probably damaging Het
Lpcat2 G T 8: 92,864,903 M58I probably benign Het
Lrrc8d G T 5: 105,814,276 V851F probably benign Het
Ltbp3 T C 19: 5,756,001 V929A probably damaging Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Map3k9 T C 12: 81,722,521 M941V probably benign Het
Myom2 A T 8: 15,084,556 Y453F probably benign Het
Ncapd2 T C 6: 125,186,784 K78E probably damaging Het
Ncor2 G T 5: 125,032,256 D1496E possibly damaging Het
Ndnf T C 6: 65,703,141 Y135H possibly damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Nsd1 G C 13: 55,268,454 E1438Q probably benign Het
Olfr1043 G T 2: 86,162,618 C110* probably null Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Olfr1413 T A 1: 92,573,789 M206K possibly damaging Het
Olfr229 A T 9: 39,910,725 R307S probably benign Het
Pom121l2 T G 13: 21,982,128 S190A probably damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Scarb1 A C 5: 125,287,411 C85G probably damaging Het
Sh2d4b A G 14: 40,872,546 I159T probably damaging Het
Sntg1 C T 1: 8,782,901 probably benign Het
Sos1 G A 17: 80,424,181 T630I probably damaging Het
Spata7 T A 12: 98,669,473 D517E probably damaging Het
Tcaf1 T C 6: 42,679,059 T328A probably benign Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Trpc2 T A 7: 102,093,574 M597K probably damaging Het
Ttc37 T G 13: 76,130,219 L551V probably damaging Het
Tubb3 C A 8: 123,421,264 T312N probably damaging Het
Ubr4 G A 4: 139,393,094 V277M probably damaging Het
Uhrf2 G A 19: 30,079,861 R473Q probably damaging Het
Vmn2r43 T A 7: 8,255,320 H298L probably benign Het
Other mutations in Nmur2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Nmur2 APN 11 56040777 missense probably damaging 0.99
IGL01591:Nmur2 APN 11 56026999 missense probably benign
IGL01960:Nmur2 APN 11 56040511 missense probably damaging 0.99
IGL02108:Nmur2 APN 11 56040364 missense probably benign 0.33
IGL02602:Nmur2 APN 11 56027063 missense probably benign 0.19
R0324:Nmur2 UTSW 11 56040520 missense probably damaging 1.00
R0458:Nmur2 UTSW 11 56040568 missense possibly damaging 0.93
R0718:Nmur2 UTSW 11 56029498 splice site probably benign
R1799:Nmur2 UTSW 11 56029621 missense probably damaging 1.00
R2099:Nmur2 UTSW 11 56040763 missense probably benign 0.00
R2263:Nmur2 UTSW 11 56029561 missense probably damaging 0.97
R3701:Nmur2 UTSW 11 56040777 missense probably damaging 0.99
R3705:Nmur2 UTSW 11 56040474 missense probably damaging 1.00
R4083:Nmur2 UTSW 11 56040225 missense probably damaging 1.00
R4744:Nmur2 UTSW 11 56040835 missense probably benign 0.01
R4747:Nmur2 UTSW 11 56040279 missense probably benign 0.05
R5288:Nmur2 UTSW 11 56040214 missense probably damaging 1.00
R5384:Nmur2 UTSW 11 56040214 missense probably damaging 1.00
R5579:Nmur2 UTSW 11 56033009 missense probably benign 0.00
R6329:Nmur2 UTSW 11 56029585 missense probably benign 0.30
R6477:Nmur2 UTSW 11 56029591 missense probably damaging 1.00
X0062:Nmur2 UTSW 11 56040849 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACGGAGACCAAGCTGATTTTACC -3'
(R):5'- AGCCTAGTCTGGAGCTTCTC -3'

Sequencing Primer
(F):5'- GAGACCAAGCTGATTTTACCTGTGAG -3'
(R):5'- CCTAGTCTGGAGCTTCTCTGTGG -3'
Posted On2015-04-17