Incidental Mutation 'R3951:Akr1c18'
ID307960
Institutional Source Beutler Lab
Gene Symbol Akr1c18
Ensembl Gene ENSMUSG00000021214
Gene Namealdo-keto reductase family 1, member C18
Synonyms20alpha-HSD, 20alpha-hydroxysteroid dehydrogenase
MMRRC Submission 040828-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R3951 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location4132615-4150654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4135285 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 283 (V283I)
Ref Sequence ENSEMBL: ENSMUSP00000021635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021635] [ENSMUST00000110704]
Predicted Effect probably benign
Transcript: ENSMUST00000021635
AA Change: V283I

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000021635
Gene: ENSMUSG00000021214
AA Change: V283I

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 18 301 4.2e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110704
AA Change: V257I

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106332
Gene: ENSMUSG00000021214
AA Change: V257I

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 18 275 1.1e-50 PFAM
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. These enzymes catalyze the conversion of aldehydes and ketones to their corresponding alcohols by utilizing NADH and/or NADPH as cofactors. The enzymes display overlapping but distinct substrate specificity. This enzyme catalyzes the reduction of prostaglandin (PG) D2, PGH2 and phenanthrenequinone (PQ), and the oxidation of 9alpha,11beta-PGF2 to PGD2. It may play an important role in the pathogenesis of allergic diseases such as asthma, and may also have a role in controlling cell growth and/or differentiation. This gene shares high sequence identity with three other gene members and is clustered with those three genes at chromosome 10p15-p14. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display prolonged pregnancies and decreased number of pups. Some cannot induce parturition while others are able to give birth but show a prolonged estrous cycle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T C 10: 100,615,296 probably benign Het
4932414N04Rik T C 2: 68,664,403 probably null Het
Atp2b2 T A 6: 113,760,831 M861L possibly damaging Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Clspn A G 4: 126,576,379 E814G probably damaging Het
Csgalnact1 T C 8: 68,461,262 Q97R probably benign Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Ect2 A T 3: 27,130,120 D517E probably benign Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat2 T C 11: 55,296,382 T1213A probably benign Het
Fkbp8 T A 8: 70,532,661 L275Q probably damaging Het
Gabrb2 A G 11: 42,626,881 Y510C probably damaging Het
Gda T C 19: 21,472,445 T16A probably benign Het
Ggcx G A 6: 72,426,558 G363R probably benign Het
Gm527 T G 12: 64,923,502 probably benign Het
Hoxb2 A G 11: 96,353,175 E204G probably damaging Het
Hsd17b11 G A 5: 103,992,937 probably benign Het
Kat14 T C 2: 144,407,329 probably benign Het
Kif16b C T 2: 142,707,359 V1079I probably benign Het
Klhl29 T A 12: 5,140,660 S112C probably damaging Het
Lpcat2 G T 8: 92,864,903 M58I probably benign Het
Lrrc8d G T 5: 105,814,276 V851F probably benign Het
Ltbp3 T C 19: 5,756,001 V929A probably damaging Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Map3k9 T C 12: 81,722,521 M941V probably benign Het
Myom2 A T 8: 15,084,556 Y453F probably benign Het
Ncapd2 T C 6: 125,186,784 K78E probably damaging Het
Ncor2 G T 5: 125,032,256 D1496E possibly damaging Het
Ndnf T C 6: 65,703,141 Y135H possibly damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Nmur2 G C 11: 56,040,225 P220R probably damaging Het
Nsd1 G C 13: 55,268,454 E1438Q probably benign Het
Olfr1043 G T 2: 86,162,618 C110* probably null Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Olfr1413 T A 1: 92,573,789 M206K possibly damaging Het
Olfr229 A T 9: 39,910,725 R307S probably benign Het
Pom121l2 T G 13: 21,982,128 S190A probably damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Scarb1 A C 5: 125,287,411 C85G probably damaging Het
Sh2d4b A G 14: 40,872,546 I159T probably damaging Het
Sntg1 C T 1: 8,782,901 probably benign Het
Sos1 G A 17: 80,424,181 T630I probably damaging Het
Spata7 T A 12: 98,669,473 D517E probably damaging Het
Tcaf1 T C 6: 42,679,059 T328A probably benign Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Trpc2 T A 7: 102,093,574 M597K probably damaging Het
Ttc37 T G 13: 76,130,219 L551V probably damaging Het
Tubb3 C A 8: 123,421,264 T312N probably damaging Het
Ubr4 G A 4: 139,393,094 V277M probably damaging Het
Uhrf2 G A 19: 30,079,861 R473Q probably damaging Het
Vmn2r43 T A 7: 8,255,320 H298L probably benign Het
Other mutations in Akr1c18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Akr1c18 APN 13 4137233 missense probably damaging 1.00
IGL01458:Akr1c18 APN 13 4137144 missense probably damaging 1.00
R0321:Akr1c18 UTSW 13 4135244 missense probably damaging 1.00
R0514:Akr1c18 UTSW 13 4137191 missense probably benign 0.00
R0653:Akr1c18 UTSW 13 4145308 missense probably damaging 1.00
R1006:Akr1c18 UTSW 13 4136655 missense probably benign 0.00
R1345:Akr1c18 UTSW 13 4145214 missense possibly damaging 0.94
R1656:Akr1c18 UTSW 13 4145253 missense probably benign 0.12
R1887:Akr1c18 UTSW 13 4143288 missense probably benign 0.02
R2015:Akr1c18 UTSW 13 4145309 missense probably damaging 1.00
R2570:Akr1c18 UTSW 13 4142164 missense probably benign 0.04
R4717:Akr1c18 UTSW 13 4136718 missense probably benign 0.00
R5414:Akr1c18 UTSW 13 4136735 missense probably damaging 1.00
R5540:Akr1c18 UTSW 13 4137179 missense probably benign 0.22
R5723:Akr1c18 UTSW 13 4144329 nonsense probably null
R6797:Akr1c18 UTSW 13 4145277 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACTGGTCTTTGATGTCCTCATATTG -3'
(R):5'- AAGGGTCCTCTTCAAGCCAG -3'

Sequencing Primer
(F):5'- GGTCACTTCTGACAGACA -3'
(R):5'- CTGAGTCCTTTGACCAGGAATG -3'
Posted On2015-04-17