Incidental Mutation 'R3951:Ltbp3'
ID307968
Institutional Source Beutler Lab
Gene Symbol Ltbp3
Ensembl Gene ENSMUSG00000024940
Gene Namelatent transforming growth factor beta binding protein 3
SynonymsLtbp2
MMRRC Submission 040828-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.468) question?
Stock #R3951 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5740904-5758532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5756001 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 929 (V929A)
Ref Sequence ENSEMBL: ENSMUSP00000080214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025890] [ENSMUST00000081496]
Predicted Effect probably benign
Transcript: ENSMUST00000025890
SMART Domains Protein: ENSMUSP00000025890
Gene: ENSMUSG00000024941

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
Pfam:Pkinase_Tyr 30 254 3.3e-11 PFAM
Pfam:Pkinase 31 252 2e-14 PFAM
SCOP:d1gw5a_ 350 536 1e-18 SMART
low complexity region 556 577 N/A INTRINSIC
low complexity region 608 620 N/A INTRINSIC
coiled coil region 759 795 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000081496
AA Change: V929A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080214
Gene: ENSMUSG00000024940
AA Change: V929A

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
EGF 109 138 6.76e-3 SMART
low complexity region 140 154 N/A INTRINSIC
low complexity region 191 199 N/A INTRINSIC
low complexity region 221 233 N/A INTRINSIC
low complexity region 254 273 N/A INTRINSIC
Pfam:TB 286 323 8e-9 PFAM
EGF_CA 352 392 2.08e-12 SMART
Pfam:TB 411 451 4.8e-18 PFAM
low complexity region 526 537 N/A INTRINSIC
EGF_CA 571 612 8.71e-6 SMART
EGF_CA 613 656 2.8e-9 SMART
EGF_CA 657 699 2.48e-10 SMART
EGF_CA 700 740 4.96e-10 SMART
EGF_CA 741 781 1.69e-12 SMART
EGF_CA 782 822 1.94e-12 SMART
EGF_CA 823 862 3.27e-10 SMART
EGF_CA 863 905 3.32e-11 SMART
Pfam:TB 925 967 5.7e-16 PFAM
EGF_CA 990 1032 4.49e-8 SMART
EGF_CA 1033 1073 3.17e-8 SMART
Pfam:TB 1097 1134 1.2e-11 PFAM
EGF 1170 1203 1.53e1 SMART
EGF_CA 1204 1248 1.53e-10 SMART
Meta Mutation Damage Score 0.252 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with transforming growth factor beta (TGF-beta) proteins and may be involved in their subcellular localization. Activation of this complex requires removal of the encoded binding protein. This protein also may play a structural role in the extracellular matrix. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit craniofacial malformations including an overshot mandible and ossification of synchondroses. Mutants develop osteosclerosis of long bones and osteoarthritis, and, in some cases, high corticosterone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T C 10: 100,615,296 probably benign Het
4932414N04Rik T C 2: 68,664,403 probably null Het
Akr1c18 C T 13: 4,135,285 V283I probably benign Het
Atp2b2 T A 6: 113,760,831 M861L possibly damaging Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Clspn A G 4: 126,576,379 E814G probably damaging Het
Csgalnact1 T C 8: 68,461,262 Q97R probably benign Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Ect2 A T 3: 27,130,120 D517E probably benign Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Fat2 T C 11: 55,296,382 T1213A probably benign Het
Fkbp8 T A 8: 70,532,661 L275Q probably damaging Het
Gabrb2 A G 11: 42,626,881 Y510C probably damaging Het
Gda T C 19: 21,472,445 T16A probably benign Het
Ggcx G A 6: 72,426,558 G363R probably benign Het
Gm527 T G 12: 64,923,502 probably benign Het
Hoxb2 A G 11: 96,353,175 E204G probably damaging Het
Hsd17b11 G A 5: 103,992,937 probably benign Het
Kat14 T C 2: 144,407,329 probably benign Het
Kif16b C T 2: 142,707,359 V1079I probably benign Het
Klhl29 T A 12: 5,140,660 S112C probably damaging Het
Lpcat2 G T 8: 92,864,903 M58I probably benign Het
Lrrc8d G T 5: 105,814,276 V851F probably benign Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Map3k9 T C 12: 81,722,521 M941V probably benign Het
Myom2 A T 8: 15,084,556 Y453F probably benign Het
Ncapd2 T C 6: 125,186,784 K78E probably damaging Het
Ncor2 G T 5: 125,032,256 D1496E possibly damaging Het
Ndnf T C 6: 65,703,141 Y135H possibly damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Nmur2 G C 11: 56,040,225 P220R probably damaging Het
Nsd1 G C 13: 55,268,454 E1438Q probably benign Het
Olfr1043 G T 2: 86,162,618 C110* probably null Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Olfr1413 T A 1: 92,573,789 M206K possibly damaging Het
Olfr229 A T 9: 39,910,725 R307S probably benign Het
Pom121l2 T G 13: 21,982,128 S190A probably damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Scarb1 A C 5: 125,287,411 C85G probably damaging Het
Sh2d4b A G 14: 40,872,546 I159T probably damaging Het
Sntg1 C T 1: 8,782,901 probably benign Het
Sos1 G A 17: 80,424,181 T630I probably damaging Het
Spata7 T A 12: 98,669,473 D517E probably damaging Het
Tcaf1 T C 6: 42,679,059 T328A probably benign Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Trpc2 T A 7: 102,093,574 M597K probably damaging Het
Ttc37 T G 13: 76,130,219 L551V probably damaging Het
Tubb3 C A 8: 123,421,264 T312N probably damaging Het
Ubr4 G A 4: 139,393,094 V277M probably damaging Het
Uhrf2 G A 19: 30,079,861 R473Q probably damaging Het
Vmn2r43 T A 7: 8,255,320 H298L probably benign Het
Other mutations in Ltbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Ltbp3 APN 19 5756016 missense probably damaging 0.99
IGL00978:Ltbp3 APN 19 5754019 missense probably benign 0.26
IGL01517:Ltbp3 APN 19 5757732 missense possibly damaging 0.57
IGL01529:Ltbp3 APN 19 5747839 missense probably benign 0.06
IGL03119:Ltbp3 APN 19 5757443 missense probably damaging 0.98
csp UTSW 19 5747688 missense probably damaging 1.00
R0211:Ltbp3 UTSW 19 5752143 critical splice donor site probably null
R0718:Ltbp3 UTSW 19 5746748 splice site probably benign
R1103:Ltbp3 UTSW 19 5747411 critical splice acceptor site probably null
R1103:Ltbp3 UTSW 19 5747412 critical splice acceptor site probably null
R1299:Ltbp3 UTSW 19 5745428 splice site probably benign
R1510:Ltbp3 UTSW 19 5748887 missense probably benign 0.02
R1616:Ltbp3 UTSW 19 5746967 missense probably damaging 1.00
R1682:Ltbp3 UTSW 19 5751754 missense probably benign 0.02
R1752:Ltbp3 UTSW 19 5745657 missense probably benign 0.09
R1806:Ltbp3 UTSW 19 5753942 nonsense probably null
R1866:Ltbp3 UTSW 19 5747849 missense probably benign 0.43
R1981:Ltbp3 UTSW 19 5758079 missense probably benign 0.15
R2211:Ltbp3 UTSW 19 5753962 missense possibly damaging 0.79
R2239:Ltbp3 UTSW 19 5751523 nonsense probably null
R2261:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R2263:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R2380:Ltbp3 UTSW 19 5751523 nonsense probably null
R2412:Ltbp3 UTSW 19 5746645 missense probably benign 0.08
R2446:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R2449:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3056:Ltbp3 UTSW 19 5751406 missense probably benign 0.11
R3080:Ltbp3 UTSW 19 5756888 frame shift probably null
R3863:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3864:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3961:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3962:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3963:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3972:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R4028:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R4031:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R4041:Ltbp3 UTSW 19 5751871 missense possibly damaging 0.95
R4060:Ltbp3 UTSW 19 5742320 missense probably benign 0.41
R4296:Ltbp3 UTSW 19 5756582 critical splice acceptor site probably null
R4525:Ltbp3 UTSW 19 5746359 missense probably benign 0.09
R4660:Ltbp3 UTSW 19 5748786 intron probably null
R4794:Ltbp3 UTSW 19 5756679 missense probably damaging 1.00
R4980:Ltbp3 UTSW 19 5753927 critical splice acceptor site probably null
R5071:Ltbp3 UTSW 19 5756823 missense probably damaging 1.00
R5702:Ltbp3 UTSW 19 5747821 missense probably benign
R5771:Ltbp3 UTSW 19 5747544 missense probably damaging 1.00
R6021:Ltbp3 UTSW 19 5753680 missense probably benign 0.00
R6053:Ltbp3 UTSW 19 5752094 missense probably damaging 0.98
R6321:Ltbp3 UTSW 19 5745657 missense probably benign 0.09
R6339:Ltbp3 UTSW 19 5747477 missense probably damaging 1.00
R6371:Ltbp3 UTSW 19 5745772 splice site probably null
R6709:Ltbp3 UTSW 19 5747857 critical splice donor site probably null
X0066:Ltbp3 UTSW 19 5751277 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGAAGAAATCCTCTTTGCCTGGG -3'
(R):5'- ACCCAGAGCCCTTTGGTTTC -3'

Sequencing Primer
(F):5'- TGGAGTTAGACCTCTCCCCAG -3'
(R):5'- CCCTTTGGTTTCCAGATGACCAAAAG -3'
Posted On2015-04-17