Incidental Mutation 'R3952:1700017N19Rik'
List |< first << previous [record 43 of 19097] next >> last >|
ID308005
Institutional Source Beutler Lab
Gene Symbol 1700017N19Rik
Ensembl Gene ENSMUSG00000056912
Gene NameRIKEN cDNA 1700017N19 gene
Synonyms
MMRRC Submission 040829-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R3952 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location100590484-100618401 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 100615296 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151731 (fasta)
Gene Model
Predicted Effect probably benign
Transcript: ENSMUST00000041162
Predicted Effect probably benign
Transcript: ENSMUST00000186825
Predicted Effect probably benign
Transcript: ENSMUST00000187119
Predicted Effect probably benign
Transcript: ENSMUST00000188736
Predicted Effect probably benign
Transcript: ENSMUST00000190386
Predicted Effect probably benign
Transcript: ENSMUST00000190708
Predicted Effect probably benign
Transcript: ENSMUST00000191033
Predicted Effect probably benign
Transcript: ENSMUST00000191336
Predicted Effect probably benign
Transcript: ENSMUST00000218464
Meta Mutation Damage Score 0.1984 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T C 2: 85,500,204 probably benign Het
4932414N04Rik T C 2: 68,664,403 probably null Het
Abi3bp C T 16: 56,604,038 T450I possibly damaging Het
Abl1 A T 2: 31,784,537 T213S probably damaging Het
Apc2 C T 10: 80,314,484 R1762W probably damaging Het
Arl2 G T 19: 6,134,677 T182N probably benign Het
Brd8 C G 18: 34,614,444 probably benign Het
Cdh23 T C 10: 60,657,326 Y3C probably benign Het
Clca3a2 A G 3: 144,803,061 Y666H probably damaging Het
Cmya5 A G 13: 93,089,199 V3127A possibly damaging Het
Copg1 G A 6: 87,905,216 A598T probably benign Het
Dera A G 6: 137,837,120 Y100C probably damaging Het
Epha1 C A 6: 42,364,285 L535F probably damaging Het
Epha4 A T 1: 77,399,716 Y509N probably damaging Het
Ggcx G A 6: 72,426,558 G363R probably benign Het
Gm13101 C T 4: 143,965,786 W215* probably null Het
Hjurp G C 1: 88,277,215 probably benign Het
Kpna1 A T 16: 36,002,882 T35S probably benign Het
Map3k20 T G 2: 72,438,300 I550M probably damaging Het
Mgat4a A G 1: 37,450,414 probably benign Het
Mrpl48 T A 7: 100,559,923 probably benign Het
Ncapd2 T C 6: 125,186,784 K78E probably damaging Het
Ndst1 T C 18: 60,697,139 N633S probably benign Het
Olfr1128 T C 2: 87,545,065 T160A probably damaging Het
Olfr519 C A 7: 108,893,982 V142L probably benign Het
Olfr816 A G 10: 129,911,636 I214T probably benign Het
Pacs2 T C 12: 113,061,113 S408P probably damaging Het
Pcx C T 19: 4,617,967 H506Y probably benign Het
Pla2g6 G T 15: 79,313,096 P93T probably damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rcor1 A G 12: 111,039,735 probably benign Het
Rtn4ip1 T A 10: 43,909,897 probably null Het
Sytl2 T A 7: 90,381,492 probably benign Het
Tia1 T C 6: 86,416,337 F53S probably damaging Het
Ticrr T C 7: 79,682,069 L776S probably damaging Het
Tmod1 A G 4: 46,078,315 N41S probably damaging Het
Ttn T C 2: 76,752,795 I22585V possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Vps39 C T 2: 120,350,175 R43Q probably benign Het
Vwa5b2 T C 16: 20,598,361 *603Q probably null Het
Zeb1 G A 18: 5,772,716 A1002T probably benign Het
Zxdc A G 6: 90,370,467 probably null Het
Other mutations in 1700017N19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01565:1700017N19Rik APN 10 100603360 missense probably damaging 1.00
IGL02159:1700017N19Rik APN 10 100610665 missense probably damaging 1.00
IGL02556:1700017N19Rik APN 10 100610717 critical splice donor site probably null
IGL02629:1700017N19Rik APN 10 100609144 splice site probably benign
IGL02692:1700017N19Rik APN 10 100603548 missense probably benign 0.05
IGL02962:1700017N19Rik APN 10 100610593 splice site probably null
R0145:1700017N19Rik UTSW 10 100601921 missense probably damaging 0.96
R0402:1700017N19Rik UTSW 10 100609253 missense probably damaging 0.99
R1514:1700017N19Rik UTSW 10 100612867 missense probably damaging 1.00
R1519:1700017N19Rik UTSW 10 100603528 missense probably damaging 0.98
R1680:1700017N19Rik UTSW 10 100603528 missense probably damaging 0.98
R1686:1700017N19Rik UTSW 10 100612860 missense probably damaging 0.97
R3951:1700017N19Rik UTSW 10 100615296 splice site probably benign
R4423:1700017N19Rik UTSW 10 100605633 missense probably damaging 0.99
R4905:1700017N19Rik UTSW 10 100612818 unclassified probably null
R5507:1700017N19Rik UTSW 10 100609233 missense probably benign 0.02
R5898:1700017N19Rik UTSW 10 100612900 missense possibly damaging 0.56
R5898:1700017N19Rik UTSW 10 100615208 missense probably benign 0.20
R5977:1700017N19Rik UTSW 10 100615244 missense probably damaging 0.99
Z1088:1700017N19Rik UTSW 10 100605639 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTACTGCTGAGATGTTTATAGCTTTG -3'
(R):5'- TGATAACTTCAGCAAGACAGCATG -3'

Sequencing Primer
(F):5'- CTGAGATGTTTATAGCTTTGAAATGC -3'
(R):5'- TCAGCAAGACAGCATGTTATTTATAC -3'
Posted On2015-04-17