Incidental Mutation 'R3953:Tspan32'
| ID |
308051 |
| Institutional Source |
Beutler Lab
|
| Gene Symbol |
Tspan32
|
| Ensembl Gene |
ENSMUSG00000000244 |
| Gene Name |
tetraspanin 32 |
| Synonyms |
Tspan32, Art-1, Tssc6, Phemx, D7Wsu37e |
| MMRRC Submission |
040830-MU
|
| Accession Numbers |
|
| Essential gene? |
Non essential
(E-score: 0.000)
|
| Stock # |
R3953 (G1)
|
| Quality Score |
225 |
|
Status
|
Validated
|
| Chromosome |
7 |
| Chromosomal Location |
142558644-142573223 bp(+) (GRCm39) |
| Type of Mutation |
missense |
| DNA Base Change (assembly) |
T to A
at 142560735 bp (GRCm39)
|
| Zygosity |
Heterozygous |
| Amino Acid Change |
Methionine to Lysine
at position 61
(M61K)
|
| Ref Sequence |
ENSEMBL: ENSMUSP00000115344
(fasta)
|
| Gene Model |
predicted gene model for transcript(s):
[ENSMUST00000009396]
[ENSMUST00000075172]
[ENSMUST00000082008]
[ENSMUST00000105923]
[ENSMUST00000105924]
[ENSMUST00000105925]
[ENSMUST00000143512]
[ENSMUST00000145212]
[ENSMUST00000207211]
|
| AlphaFold |
Q9JHH2 |
| Predicted Effect |
possibly damaging
Transcript: ENSMUST00000009396
AA Change: M91K
PolyPhen 2
Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
|
| SMART Domains |
Protein: ENSMUSP00000009396
Gene: ENSMUSG00000000244
AA Change: M91K
| Domain | Start | End | E-Value | Type |
|---|
|
Pfam:Tetraspannin
|
9 |
223 |
3.2e-16 |
PFAM |
|
| Predicted Effect |
possibly damaging
Transcript: ENSMUST00000075172
AA Change: M64K
PolyPhen 2
Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
|
| SMART Domains |
Protein: ENSMUSP00000074667
Gene: ENSMUSG00000000244
AA Change: M64K
| Domain | Start | End | E-Value | Type |
|---|
|
Pfam:Tetraspannin
|
1 |
198 |
3.1e-13 |
PFAM |
|
| Predicted Effect |
possibly damaging
Transcript: ENSMUST00000082008
AA Change: M64K
PolyPhen 2
Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
|
| SMART Domains |
Protein: ENSMUSP00000080668
Gene: ENSMUSG00000000244
AA Change: M64K
| Domain | Start | End | E-Value | Type |
|---|
|
Pfam:Tetraspannin
|
1 |
146 |
7.1e-13 |
PFAM |
|
transmembrane domain
|
155 |
174 |
N/A |
INTRINSIC |
|
| Predicted Effect |
possibly damaging
Transcript: ENSMUST00000105923
AA Change: M64K
PolyPhen 2
Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
|
| SMART Domains |
Protein: ENSMUSP00000101543
Gene: ENSMUSG00000000244
AA Change: M64K
| Domain | Start | End | E-Value | Type |
|---|
|
transmembrane domain
|
33 |
55 |
N/A |
INTRINSIC |
|
transmembrane domain
|
62 |
84 |
N/A |
INTRINSIC |
|
transmembrane domain
|
121 |
140 |
N/A |
INTRINSIC |
|
| Predicted Effect |
probably damaging
Transcript: ENSMUST00000105924
AA Change: M64K
PolyPhen 2
Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
|
| SMART Domains |
Protein: ENSMUSP00000101544
Gene: ENSMUSG00000000244
AA Change: M64K
| Domain | Start | End | E-Value | Type |
|---|
|
Pfam:Tetraspannin
|
1 |
148 |
1.8e-13 |
PFAM |
|
| Predicted Effect |
possibly damaging
Transcript: ENSMUST00000105925
AA Change: M64K
PolyPhen 2
Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
|
| SMART Domains |
Protein: ENSMUSP00000101545
Gene: ENSMUSG00000000244
AA Change: M64K
| Domain | Start | End | E-Value | Type |
|---|
|
transmembrane domain
|
33 |
55 |
N/A |
INTRINSIC |
|
transmembrane domain
|
65 |
87 |
N/A |
INTRINSIC |
|
| Predicted Effect |
noncoding transcript
Transcript: ENSMUST00000131740
|
| Predicted Effect |
probably damaging
Transcript: ENSMUST00000143512
AA Change: M61K
PolyPhen 2
Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
|
| SMART Domains |
Protein: ENSMUSP00000115344
Gene: ENSMUSG00000000244
AA Change: M61K
| Domain | Start | End | E-Value | Type |
|---|
|
transmembrane domain
|
29 |
51 |
N/A |
INTRINSIC |
|
transmembrane domain
|
146 |
168 |
N/A |
INTRINSIC |
|
| Predicted Effect |
noncoding transcript
Transcript: ENSMUST00000141186
|
| Predicted Effect |
possibly damaging
Transcript: ENSMUST00000145212
AA Change: M64K
PolyPhen 2
Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
|
| SMART Domains |
Protein: ENSMUSP00000116212
Gene: ENSMUSG00000000244
AA Change: M64K
| Domain | Start | End | E-Value | Type |
|---|
|
transmembrane domain
|
33 |
55 |
N/A |
INTRINSIC |
|
transmembrane domain
|
62 |
84 |
N/A |
INTRINSIC |
|
| Predicted Effect |
possibly damaging
Transcript: ENSMUST00000207211
AA Change: M64K
PolyPhen 2
Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
|
| Predicted Effect |
noncoding transcript
Transcript: ENSMUST00000207449
|
| Meta Mutation Damage Score |
0.6687 |
| Coding Region Coverage |
- 1x: 99.2%
- 3x: 98.5%
- 10x: 97.1%
- 20x: 94.5%
|
| Validation Efficiency |
100% (61/61) |
| MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is a member of the tetraspanin superfamily, is one of several tumor-suppressing subtransferable fragments located in the imprinted gene domain of chromosome 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian and breast cancers. This gene is located among several imprinted genes; however, this gene, as well as the tumor-suppressing subchromosomal transferable fragment 4, escapes imprinting. This gene may play a role in malignancies and diseases that involve this region, and it is also involved in hematopoietic cell function. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap null mutation exhibit normal hematopoiesis, hemolytic and granulopoitic responses. B cells exhibit normal proliferative responses while T cells demonstrate enhanced proliferation upon T cell receptor stimulation. [provided by MGI curators]
|
| Allele List at MGI |
|
| Other mutations in this stock |
Total: 59 list
| Gene | Ref | Var | Chr/Loc | Mutation | Predicted Effect | Zygosity |
|---|
| Adam2 |
G |
A |
14: 66,295,059 (GRCm39) |
S262L |
probably damaging |
Het |
| Adgrf1 |
A |
G |
17: 43,621,098 (GRCm39) |
N445S |
probably benign |
Het |
| Aldh7a1 |
C |
A |
18: 56,681,577 (GRCm39) |
V198L |
probably damaging |
Het |
| Ank2 |
A |
T |
3: 126,781,809 (GRCm39) |
D6E |
probably damaging |
Het |
| Arhgap31 |
A |
G |
16: 38,423,826 (GRCm39) |
F747L |
probably benign |
Het |
| B4galt3 |
C |
A |
1: 171,101,613 (GRCm39) |
H196N |
probably damaging |
Het |
| Cadps |
T |
C |
14: 12,505,937 (GRCm38) |
D711G |
probably damaging |
Het |
| Clspn |
ACGGCGGCGGC |
A |
4: 126,460,230 (GRCm39) |
|
probably null |
Het |
| Cpsf3 |
A |
G |
12: 21,363,806 (GRCm39) |
D632G |
probably benign |
Het |
| Cyp4f18 |
C |
T |
8: 72,754,801 (GRCm39) |
R148H |
probably damaging |
Het |
| Dennd4a |
C |
A |
9: 64,759,857 (GRCm39) |
P321T |
probably damaging |
Het |
| Dennd5a |
A |
G |
7: 109,504,906 (GRCm39) |
M868T |
probably benign |
Het |
| Dipk1b |
C |
T |
2: 26,525,579 (GRCm39) |
P171L |
probably benign |
Het |
| Dnah2 |
G |
A |
11: 69,344,929 (GRCm39) |
T2715M |
probably damaging |
Het |
| Evc2 |
T |
C |
5: 37,537,931 (GRCm39) |
|
probably null |
Het |
| Fkbp8 |
T |
G |
8: 70,987,517 (GRCm39) |
S376A |
probably damaging |
Het |
| Gucy1a2 |
T |
C |
9: 3,582,704 (GRCm39) |
|
probably benign |
Het |
| Gys1 |
C |
T |
7: 45,089,470 (GRCm39) |
P274S |
probably damaging |
Het |
| Hbq1a |
T |
C |
11: 32,250,214 (GRCm39) |
|
probably null |
Het |
| Herc1 |
C |
T |
9: 66,341,075 (GRCm39) |
Q1731* |
probably null |
Het |
| Igfn1 |
A |
G |
1: 135,894,918 (GRCm39) |
Y1883H |
possibly damaging |
Het |
| Lmf1 |
G |
A |
17: 25,873,445 (GRCm39) |
V317M |
probably damaging |
Het |
| Lnx1 |
T |
C |
5: 74,766,750 (GRCm39) |
T455A |
probably benign |
Het |
| Mast2 |
A |
T |
4: 116,170,926 (GRCm39) |
H612Q |
probably damaging |
Het |
| Mcm9 |
G |
A |
10: 53,439,440 (GRCm39) |
H578Y |
probably damaging |
Het |
| Mefv |
A |
G |
16: 3,533,264 (GRCm39) |
S336P |
possibly damaging |
Het |
| Micu1 |
A |
T |
10: 59,586,326 (GRCm39) |
H134L |
probably benign |
Het |
| Mrgprb2 |
C |
T |
7: 48,202,116 (GRCm39) |
G203D |
possibly damaging |
Het |
| Ncapd2 |
T |
C |
6: 125,147,697 (GRCm39) |
I1179V |
probably damaging |
Het |
| Nek7 |
C |
A |
1: 138,462,127 (GRCm39) |
C79F |
probably damaging |
Het |
| Nup210l |
A |
T |
3: 90,100,361 (GRCm39) |
R1462S |
possibly damaging |
Het |
| Or14j6 |
A |
T |
17: 38,214,500 (GRCm39) |
H21L |
probably benign |
Het |
| Or51f1 |
A |
G |
7: 102,505,824 (GRCm39) |
C222R |
probably damaging |
Het |
| Or5al1 |
A |
G |
2: 85,990,282 (GRCm39) |
V144A |
probably benign |
Het |
| Or5b119 |
G |
A |
19: 13,456,806 (GRCm39) |
S252L |
probably benign |
Het |
| Pcnx3 |
A |
G |
19: 5,733,808 (GRCm39) |
|
probably benign |
Het |
| Pi4ka |
A |
G |
16: 17,103,145 (GRCm39) |
|
probably benign |
Het |
| Ptgir |
A |
G |
7: 16,640,794 (GRCm39) |
M29V |
possibly damaging |
Het |
| Ptprb |
A |
G |
10: 116,177,399 (GRCm39) |
N1320S |
probably benign |
Het |
| Ralgapa2 |
C |
T |
2: 146,277,884 (GRCm39) |
V426I |
probably damaging |
Het |
| Rhobtb2 |
T |
C |
14: 70,031,488 (GRCm39) |
T546A |
possibly damaging |
Het |
| Robo1 |
A |
G |
16: 72,821,226 (GRCm39) |
D1331G |
probably damaging |
Het |
| Sgcz |
A |
G |
8: 37,993,346 (GRCm39) |
|
probably benign |
Het |
| Slc26a1 |
T |
C |
5: 108,821,448 (GRCm39) |
D147G |
possibly damaging |
Het |
| Slc44a5 |
A |
G |
3: 153,877,209 (GRCm39) |
D13G |
probably benign |
Het |
| Slco1a1 |
A |
T |
6: 141,868,833 (GRCm39) |
M377K |
probably damaging |
Het |
| St18 |
T |
A |
1: 6,873,117 (GRCm39) |
L284Q |
probably damaging |
Het |
| Tbc1d9 |
C |
T |
8: 83,960,161 (GRCm39) |
T138I |
probably damaging |
Het |
| Tec |
T |
C |
5: 72,939,520 (GRCm39) |
|
probably null |
Het |
| Tln2 |
G |
A |
9: 67,277,911 (GRCm39) |
P368S |
probably damaging |
Het |
| Tmem131l |
C |
A |
3: 83,817,726 (GRCm39) |
C1257F |
probably damaging |
Het |
| Tmf1 |
C |
A |
6: 97,153,167 (GRCm39) |
R302L |
probably damaging |
Het |
| Tnip3 |
A |
T |
6: 65,574,379 (GRCm39) |
T137S |
possibly damaging |
Het |
| Trim30d |
C |
T |
7: 104,121,728 (GRCm39) |
G339D |
probably damaging |
Het |
| Ttc6 |
T |
C |
12: 57,744,238 (GRCm39) |
V1290A |
probably benign |
Het |
| Ttn |
A |
G |
2: 76,799,593 (GRCm39) |
V429A |
possibly damaging |
Het |
| Vmn2r95 |
T |
A |
17: 18,660,358 (GRCm39) |
Y257N |
possibly damaging |
Het |
| Vps13d |
A |
G |
4: 144,875,450 (GRCm39) |
S1686P |
probably damaging |
Het |
| Wdr41 |
A |
G |
13: 95,133,571 (GRCm39) |
E75G |
probably damaging |
Het |
|
| Other mutations in Tspan32 |
| Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
|---|
|
IGL01466:Tspan32
|
APN |
7 |
142,568,691 (GRCm39) |
intron |
probably benign |
|
|
IGL02122:Tspan32
|
APN |
7 |
142,569,372 (GRCm39) |
missense |
probably damaging |
0.99 |
|
IGL02830:Tspan32
|
APN |
7 |
142,571,329 (GRCm39) |
missense |
possibly damaging |
0.93 |
|
theron
|
UTSW |
7 |
142,571,328 (GRCm39) |
missense |
probably benign |
0.37 |
|
R0594:Tspan32
|
UTSW |
7 |
142,569,347 (GRCm39) |
missense |
probably damaging |
0.98 |
|
R1162:Tspan32
|
UTSW |
7 |
142,560,735 (GRCm39) |
missense |
probably damaging |
1.00 |
|
R1317:Tspan32
|
UTSW |
7 |
142,571,328 (GRCm39) |
missense |
probably benign |
0.37 |
|
R1513:Tspan32
|
UTSW |
7 |
142,558,886 (GRCm39) |
missense |
probably null |
0.05 |
|
R2941:Tspan32
|
UTSW |
7 |
142,568,729 (GRCm39) |
missense |
probably damaging |
1.00 |
|
R3955:Tspan32
|
UTSW |
7 |
142,560,735 (GRCm39) |
missense |
probably damaging |
1.00 |
|
R3957:Tspan32
|
UTSW |
7 |
142,560,735 (GRCm39) |
missense |
probably damaging |
1.00 |
|
R5021:Tspan32
|
UTSW |
7 |
142,568,715 (GRCm39) |
missense |
probably damaging |
1.00 |
|
R5849:Tspan32
|
UTSW |
7 |
142,569,324 (GRCm39) |
missense |
probably damaging |
1.00 |
|
R6429:Tspan32
|
UTSW |
7 |
142,572,479 (GRCm39) |
missense |
possibly damaging |
0.59 |
|
R7205:Tspan32
|
UTSW |
7 |
142,558,863 (GRCm39) |
missense |
possibly damaging |
0.66 |
|
R7756:Tspan32
|
UTSW |
7 |
142,570,959 (GRCm39) |
missense |
probably benign |
0.32 |
|
R8218:Tspan32
|
UTSW |
7 |
142,564,832 (GRCm39) |
missense |
probably benign |
0.03 |
|
R8412:Tspan32
|
UTSW |
7 |
142,559,695 (GRCm39) |
missense |
probably benign |
|
|
| Predicted Primers |
PCR Primer
(F):5'- GAAGGTCAGTTCTAGCTCTGTG -3'
(R):5'- GAGGGTCCTGATTGAGCAAGTG -3'
Sequencing Primer
(F):5'- GCTCTGTGACTCCCAAAGTAGATAG -3'
(R):5'- TCCTGATTGAGCAAGTGGAAGGTC -3'
|
| Posted On |
2015-04-17 |
Incidental Mutation