Incidental Mutation 'R3954:Ndst4'
ID308089
Institutional Source Beutler Lab
Gene Symbol Ndst4
Ensembl Gene ENSMUSG00000027971
Gene NameN-deacetylase/N-sulfotransferase (heparin glucosaminyl) 4
Synonyms
MMRRC Submission 040831-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R3954 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location125404076-125728899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125437905 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 41 (M41T)
Ref Sequence ENSEMBL: ENSMUSP00000133341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173932]
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000144344
SMART Domains Protein: ENSMUSP00000120687
Gene: ENSMUSG00000027971

DomainStartEndE-ValueType
Pfam:HSNSD 19 505 1.3e-270 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147016
Predicted Effect probably benign
Transcript: ENSMUST00000173932
AA Change: M41T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000133341
Gene: ENSMUSG00000027971
AA Change: M41T

DomainStartEndE-ValueType
Pfam:HSNSD 20 505 1.2e-251 PFAM
Pfam:Sulfotransfer_1 594 857 1.2e-43 PFAM
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a phenotype restricted to the colonic epithelium that includes an increased number of colon goblet cells, a decreased number of colonocytes, and increased apoptosis of colonic epithelial cells in the proximal colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,384,389 S118P probably damaging Het
9330159F19Rik A G 10: 29,224,809 K393E possibly damaging Het
Aagab A G 9: 63,619,160 E155G probably damaging Het
Acad11 A G 9: 104,086,152 probably benign Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Ankle2 A G 5: 110,251,675 T633A probably benign Het
Arhgef19 A G 4: 141,256,334 Y726C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
B3galnt2 A G 13: 13,966,454 Q87R probably benign Het
Carmil1 A G 13: 24,013,407 S1349P probably benign Het
Ccdc114 A G 7: 45,941,676 K192E probably damaging Het
Cfap52 C A 11: 67,930,865 V446L probably benign Het
Cgnl1 T C 9: 71,724,663 N469D probably benign Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dlg1 T C 16: 31,858,008 Y792H probably damaging Het
Dusp13 T A 14: 21,740,107 D57V probably damaging Het
Galnt6 A G 15: 100,697,168 V484A possibly damaging Het
Gm13128 A C 4: 144,331,668 M282L probably benign Het
Hbq1a T C 11: 32,300,214 probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igkv4-79 A G 6: 69,043,245 S29P possibly damaging Het
Lamp5 G A 2: 136,061,008 D216N probably damaging Het
Me2 A G 18: 73,781,132 F443L probably damaging Het
Ncam2 G A 16: 81,589,724 V664M probably damaging Het
Nkx6-3 G T 8: 23,153,726 A48S possibly damaging Het
Ntng2 A G 2: 29,207,535 C305R probably damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Omd A T 13: 49,589,737 I88F probably benign Het
Pi4k2a G A 19: 42,115,899 A367T probably damaging Het
Prph2 T C 17: 46,910,718 F8L probably benign Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Tec T C 5: 72,782,177 probably null Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Vmn1r124 A G 7: 21,260,523 V32A possibly damaging Het
Zc3h13 T A 14: 75,329,738 S921T possibly damaging Het
Other mutations in Ndst4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Ndst4 APN 3 125438211 missense probably damaging 0.98
IGL00926:Ndst4 APN 3 125561453 missense probably benign 0.01
IGL01292:Ndst4 APN 3 125438754 missense probably damaging 1.00
IGL01797:Ndst4 APN 3 125683153 missense probably damaging 0.99
R0004:Ndst4 UTSW 3 125570826 missense probably benign 0.03
R0118:Ndst4 UTSW 3 125611561 nonsense probably null
R0652:Ndst4 UTSW 3 125611539 missense possibly damaging 0.93
R1437:Ndst4 UTSW 3 125561450 missense probably damaging 0.97
R1502:Ndst4 UTSW 3 125437758 start gained probably benign
R1900:Ndst4 UTSW 3 125697895 splice site probably null
R1960:Ndst4 UTSW 3 125438682 nonsense probably null
R2249:Ndst4 UTSW 3 125438174 missense probably benign 0.16
R2334:Ndst4 UTSW 3 125708176 missense possibly damaging 0.86
R2345:Ndst4 UTSW 3 125708120 missense possibly damaging 0.95
R3617:Ndst4 UTSW 3 125438133 missense probably benign 0.00
R3713:Ndst4 UTSW 3 125561505 missense possibly damaging 0.93
R3715:Ndst4 UTSW 3 125561505 missense possibly damaging 0.93
R4013:Ndst4 UTSW 3 125683170 missense probably damaging 1.00
R4035:Ndst4 UTSW 3 125438736 missense probably damaging 1.00
R4085:Ndst4 UTSW 3 125609482 missense probably benign
R4496:Ndst4 UTSW 3 125683273 missense probably damaging 1.00
R4498:Ndst4 UTSW 3 125438358 missense probably damaging 1.00
R5187:Ndst4 UTSW 3 125437911 missense probably damaging 0.98
R5233:Ndst4 UTSW 3 125710117 missense probably damaging 1.00
R5518:Ndst4 UTSW 3 125438456 missense probably benign
R5575:Ndst4 UTSW 3 125437830 missense probably benign 0.41
R5687:Ndst4 UTSW 3 125438609 missense possibly damaging 0.79
R5940:Ndst4 UTSW 3 125561419 splice site probably benign
R6027:Ndst4 UTSW 3 125713376 missense probably benign 0.38
R6406:Ndst4 UTSW 3 125438501 missense probably benign
R6540:Ndst4 UTSW 3 125722152 nonsense probably null
R6941:Ndst4 UTSW 3 125609511 missense possibly damaging 0.93
R7108:Ndst4 UTSW 3 125561471 missense probably damaging 0.96
R7269:Ndst4 UTSW 3 125438358 missense probably damaging 1.00
R7278:Ndst4 UTSW 3 125438303 missense probably benign 0.00
R7345:Ndst4 UTSW 3 125714659 missense probably benign 0.07
R7405:Ndst4 UTSW 3 125683216 missense probably benign
R7418:Ndst4 UTSW 3 125708151 missense probably damaging 0.99
X0027:Ndst4 UTSW 3 125437946 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTCCCATGATTTGCAATGGTTAC -3'
(R):5'- CGACTGGACTCCAAGATTGC -3'

Sequencing Primer
(F):5'- GGCAACATCTTAGTATATGTTCTCC -3'
(R):5'- GCTATAATATCTTGACCAAGTTGCG -3'
Posted On2015-04-17