Mutagenetix > Incidental Mutation

Incidental Mutation 'R3954:Prph2'

308128

Institutional Source

Beutler Lab

Gene Symbol

Prph2

Ensembl Gene

ENSMUSG00000023978

Gene Name

peripherin 2

Synonyms

Tspan22, Rd2, Nmf193, rds

MMRRC Submission

040831-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3954 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

47221404-47235859 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 47221644 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 8 (F8L)

Ref Sequence

ENSEMBL: ENSMUSP00000024773 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024773]

AlphaFold

P15499

Predicted Effect

probably benign
Transcript: ENSMUST00000024773
AA Change: F8L

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000024773
Gene: ENSMUSG00000023978
AA Change: F8L

Domain	Start	End	E-Value	Type
Pfam:Tetraspannin	16	288	2.2e-28	PFAM
low complexity region	333	346	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162469

Meta Mutation Damage Score

0.0913

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

98% (42/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It may function as an adhesion molecule involved in stabilization and compaction of outer segment disks or in the maintenance of the curvature of the rim. This protein is essential for disk morphogenesis. Defects in this gene are associated with both central and peripheral retinal degenerations. Some of the various phenotypically different disorders are autosomal dominant retinitis pigmentosa, progressive macular degeneration, macular dystrophy and retinitis pigmentosa digenic. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation display slow retinal degeneration with thinning and loss of the outer nuclear layer, loss of photoreceptor outer segments, and increased numbers of Muller cells. Heterozygous mice also display retinal degeneration and Muller cell gliosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330159F19Rik	A	G	10: 29,100,805 (GRCm39)	K393E	possibly damaging	Het
Aagab	A	G	9: 63,526,442 (GRCm39)	E155G	probably damaging	Het
Acad11	A	G	9: 103,963,351 (GRCm39)		probably benign	Het
Adam2	G	A	14: 66,295,059 (GRCm39)	S262L	probably damaging	Het
Ankle2	A	G	5: 110,399,541 (GRCm39)	T633A	probably benign	Het
Arhgef19	A	G	4: 140,983,645 (GRCm39)	Y726C	probably damaging	Het
Arsi	G	A	18: 61,049,723 (GRCm39)	G202E	probably benign	Het
B3galnt2	A	G	13: 14,141,039 (GRCm39)	Q87R	probably benign	Het
Carmil1	A	G	13: 24,197,390 (GRCm39)	S1349P	probably benign	Het
Cfap52	C	A	11: 67,821,691 (GRCm39)	V446L	probably benign	Het
Cgnl1	T	C	9: 71,631,945 (GRCm39)	N469D	probably benign	Het
Clspn	ACGGCGGCGGC	A	4: 126,460,230 (GRCm39)		probably null	Het
Cpsf3	A	G	12: 21,363,806 (GRCm39)	D632G	probably benign	Het
Cyp3a57	A	T	5: 145,286,135 (GRCm39)		probably null	Het
Dennd5a	A	G	7: 109,504,906 (GRCm39)	M868T	probably benign	Het
Dlg1	T	C	16: 31,676,826 (GRCm39)	Y792H	probably damaging	Het
Dusp13b	T	A	14: 21,790,175 (GRCm39)	D57V	probably damaging	Het
Galnt6	A	G	15: 100,595,049 (GRCm39)	V484A	possibly damaging	Het
Hbq1a	T	C	11: 32,250,214 (GRCm39)		probably null	Het
Hivep2	C	A	10: 14,004,713 (GRCm39)	T437K	probably benign	Het
Igkv4-79	A	G	6: 69,020,229 (GRCm39)	S29P	possibly damaging	Het
Lamp5	G	A	2: 135,902,928 (GRCm39)	D216N	probably damaging	Het
Me2	A	G	18: 73,914,203 (GRCm39)	F443L	probably damaging	Het
Ncam2	G	A	16: 81,386,612 (GRCm39)	V664M	probably damaging	Het
Ndst4	T	C	3: 125,231,554 (GRCm39)	M41T	probably benign	Het
Nkx6-3	G	T	8: 23,643,742 (GRCm39)	A48S	possibly damaging	Het
Ntng2	A	G	2: 29,097,547 (GRCm39)	C305R	probably damaging	Het
Nup210l	A	T	3: 90,100,361 (GRCm39)	R1462S	possibly damaging	Het
Odad1	A	G	7: 45,591,100 (GRCm39)	K192E	probably damaging	Het
Omd	A	T	13: 49,743,213 (GRCm39)	I88F	probably benign	Het
Or51f1	A	G	7: 102,505,824 (GRCm39)	C222R	probably damaging	Het
Pi4k2a	G	A	19: 42,104,338 (GRCm39)	A367T	probably damaging	Het
Pramel30	A	C	4: 144,058,238 (GRCm39)	M282L	probably benign	Het
Qng1	A	G	13: 58,532,203 (GRCm39)	S118P	probably damaging	Het
Rasgrf2	A	G	13: 92,130,974 (GRCm39)	S696P	probably damaging	Het
Slc26a1	T	C	5: 108,821,448 (GRCm39)	D147G	possibly damaging	Het
Tec	T	C	5: 72,939,520 (GRCm39)		probably null	Het
Tmem131l	C	A	3: 83,817,726 (GRCm39)	C1257F	probably damaging	Het
Trim30d	C	T	7: 104,121,728 (GRCm39)	G339D	probably damaging	Het
Ttc6	T	C	12: 57,744,238 (GRCm39)	V1290A	probably benign	Het
Vmn1r124	A	G	7: 20,994,448 (GRCm39)	V32A	possibly damaging	Het
Zc3h13	T	A	14: 75,567,178 (GRCm39)	S921T	possibly damaging	Het

Other mutations in Prph2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Prph2	APN	17	47,230,704 (GRCm39)	missense	probably damaging	0.97
IGL01087:Prph2	APN	17	47,222,085 (GRCm39)	missense	probably damaging	0.97
PIT4480001:Prph2	UTSW	17	47,222,039 (GRCm39)	frame shift	probably null
R0025:Prph2	UTSW	17	47,230,697 (GRCm39)	missense	probably benign	0.17
R2235:Prph2	UTSW	17	47,222,092 (GRCm39)	missense	probably damaging	1.00
R3120:Prph2	UTSW	17	47,234,298 (GRCm39)	missense	possibly damaging	0.49
R4864:Prph2	UTSW	17	47,221,848 (GRCm39)	missense	probably benign	0.03
R4972:Prph2	UTSW	17	47,221,733 (GRCm39)	missense	possibly damaging	0.94
R5645:Prph2	UTSW	17	47,221,593 (GRCm39)	start gained	probably benign
R5687:Prph2	UTSW	17	47,234,391 (GRCm39)	missense	probably damaging	0.99
R6494:Prph2	UTSW	17	47,222,007 (GRCm39)	missense	probably benign	0.03
R6658:Prph2	UTSW	17	47,230,790 (GRCm39)	missense	probably benign	0.05
R7775:Prph2	UTSW	17	47,221,732 (GRCm39)	missense	possibly damaging	0.82
R7778:Prph2	UTSW	17	47,221,732 (GRCm39)	missense	possibly damaging	0.82
R7824:Prph2	UTSW	17	47,221,732 (GRCm39)	missense	possibly damaging	0.82
R8098:Prph2	UTSW	17	47,230,892 (GRCm39)	missense	probably benign	0.09
R9221:Prph2	UTSW	17	47,230,818 (GRCm39)	missense	probably damaging	1.00
R9703:Prph2	UTSW	17	47,234,447 (GRCm39)	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GTTAACGGGGATCCCAAGCTAG -3'
(R):5'- TCTTCCCAGCCAGAGAGTTG -3'

Sequencing Primer
(F):5'- CCAAGCTAGGGAGGCCC -3'
(R):5'- TTCCCAGCCAGAGAGTTGAAGAC -3'

Posted On

2015-04-17