Incidental Mutation 'R0377:Izumo4'
ID30813
Institutional Source Beutler Lab
Gene Symbol Izumo4
Ensembl Gene ENSMUSG00000055862
Gene NameIZUMO family member 4
Synonyms
MMRRC Submission 038583-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0377 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80702184-80705373 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 80702840 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 42 (R42H)
Ref Sequence ENSEMBL: ENSMUSP00000151397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003438] [ENSMUST00000020420] [ENSMUST00000218090] [ENSMUST00000218184]
Predicted Effect probably benign
Transcript: ENSMUST00000003438
SMART Domains Protein: ENSMUSP00000003438
Gene: ENSMUSG00000003348

DomainStartEndE-ValueType
Mob1_phocein 34 208 6.02e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000020420
SMART Domains Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198

DomainStartEndE-ValueType
Pfam:Adaptin_N 32 583 6.6e-153 PFAM
Pfam:Cnd1 130 292 2.1e-8 PFAM
low complexity region 629 642 N/A INTRINSIC
BLVR 660 803 5.3e-80 SMART
low complexity region 835 861 N/A INTRINSIC
low complexity region 871 881 N/A INTRINSIC
coiled coil region 910 933 N/A INTRINSIC
low complexity region 947 964 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000095426
AA Change: R39H
SMART Domains Protein: ENSMUSP00000093076
Gene: ENSMUSG00000055862
AA Change: R39H

DomainStartEndE-ValueType
Pfam:IZUMO 26 167 1.1e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218058
Predicted Effect probably benign
Transcript: ENSMUST00000218090
Predicted Effect probably damaging
Transcript: ENSMUST00000218184
AA Change: R42H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000218330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219987
Meta Mutation Damage Score 0.318 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 97% (67/69)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 C A 11: 94,375,096 V107F possibly damaging Het
Acad11 T A 9: 104,081,692 probably benign Het
Ache G A 5: 137,290,928 E299K possibly damaging Het
Adam5 T C 8: 24,747,541 T618A probably benign Het
Amigo2 T A 15: 97,246,380 T54S possibly damaging Het
Anapc1 A G 2: 128,641,340 probably null Het
Armc4 G A 18: 7,127,415 R933C probably benign Het
Btaf1 A G 19: 36,989,002 K1057E probably benign Het
Cep55 T A 19: 38,071,889 L396* probably null Het
Cic C A 7: 25,285,799 H1157N probably damaging Het
Cntnap5a A T 1: 116,292,529 T690S probably benign Het
D5Ertd579e A T 5: 36,604,567 C1319S probably benign Het
Dnah6 A G 6: 73,121,992 S2027P possibly damaging Het
Dntt G A 19: 41,047,627 W369* probably null Het
Esp18 T A 17: 39,409,944 W27R probably benign Het
Fam227b A T 2: 126,125,000 probably benign Het
Fbxo31 G A 8: 121,559,102 probably benign Het
Gm13547 G A 2: 29,761,791 probably null Het
Gnl2 T A 4: 125,046,382 probably benign Het
Gpx2 G A 12: 76,795,156 Q74* probably null Het
Gucy2c A G 6: 136,750,917 probably null Het
Hoxa5 A T 6: 52,202,646 W250R probably damaging Het
Kcnj12 G A 11: 61,069,396 M71I probably benign Het
Kmt2b A T 7: 30,574,193 L2333Q probably damaging Het
Mak T C 13: 41,049,348 E177G probably damaging Het
Map3k7 T A 4: 31,985,731 I218N probably damaging Het
Mark3 T C 12: 111,629,029 L393P probably damaging Het
Msh4 A G 3: 153,896,890 S234P probably benign Het
Mug1 A G 6: 121,857,361 D367G probably benign Het
Mypn A G 10: 63,127,622 probably benign Het
Ncapg T C 5: 45,693,817 V784A probably benign Het
Nutf2 T A 8: 105,878,872 V113D probably damaging Het
Olfr1080 A T 2: 86,553,583 D180E probably damaging Het
Opn3 T C 1: 175,663,694 M258V probably damaging Het
Osbpl7 A G 11: 97,055,934 D211G probably damaging Het
Pcnx C T 12: 81,974,579 probably benign Het
Plekhd1 G A 12: 80,706,436 probably benign Het
Pnpla6 A G 8: 3,541,501 E1165G probably damaging Het
Prkab2 T A 3: 97,662,317 D66E probably benign Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Ptpn23 A T 9: 110,388,132 S885R possibly damaging Het
Rab26 A T 17: 24,530,045 probably benign Het
Rab5a G A 17: 53,500,462 M175I probably benign Het
Rassf9 T A 10: 102,545,649 D297E probably benign Het
Rimbp2 C T 5: 128,803,861 R161Q probably damaging Het
Rtp1 A G 16: 23,431,284 Y133C probably damaging Het
Sdr16c5 G A 4: 4,005,546 L263F probably benign Het
Sec14l1 T G 11: 117,149,140 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spaca1 T C 4: 34,044,267 probably null Het
Stk36 C T 1: 74,612,730 P394L probably benign Het
Stk4 T C 2: 164,096,800 I196T probably damaging Het
Sult1b1 A T 5: 87,517,376 M233K probably damaging Het
Tmem8b C T 4: 43,674,005 T212M probably damaging Het
Tmprss11g A T 5: 86,490,751 F293I probably damaging Het
Tnfsf11 T G 14: 78,299,912 T104P probably benign Het
Trmt2a G A 16: 18,249,703 R80Q possibly damaging Het
Trps1 C A 15: 50,831,778 E324* probably null Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Wdr18 G A 10: 79,967,502 R400H probably benign Het
Wdr78 A G 4: 103,048,259 V775A probably damaging Het
Zfp119b T A 17: 55,938,671 H505L probably damaging Het
Zfp619 T A 7: 39,536,797 C750* probably null Het
Zfr T C 15: 12,160,591 I750T probably benign Het
Other mutations in Izumo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02850:Izumo4 APN 10 80704198 unclassified probably benign
IGL03019:Izumo4 APN 10 80703846 unclassified probably benign
IGL03391:Izumo4 APN 10 80705113 missense probably damaging 0.97
F5770:Izumo4 UTSW 10 80703891 missense probably benign 0.02
IGL02835:Izumo4 UTSW 10 80705125 missense probably benign
R0304:Izumo4 UTSW 10 80702936 missense probably damaging 1.00
R0411:Izumo4 UTSW 10 80703084 missense probably damaging 0.99
R0498:Izumo4 UTSW 10 80704196 critical splice donor site probably null
R1822:Izumo4 UTSW 10 80703895 missense probably damaging 1.00
R1870:Izumo4 UTSW 10 80703735 missense probably damaging 1.00
R1977:Izumo4 UTSW 10 80703121 missense probably damaging 1.00
R2237:Izumo4 UTSW 10 80702830 missense probably damaging 1.00
R5288:Izumo4 UTSW 10 80702805 nonsense probably null
R5543:Izumo4 UTSW 10 80702834 missense probably damaging 1.00
R5587:Izumo4 UTSW 10 80703220 missense probably damaging 1.00
R6199:Izumo4 UTSW 10 80702873 missense probably damaging 1.00
R6222:Izumo4 UTSW 10 80703051 missense probably damaging 1.00
R6349:Izumo4 UTSW 10 80702717 start codon destroyed probably null 0.02
V7580:Izumo4 UTSW 10 80703891 missense probably benign 0.02
V7581:Izumo4 UTSW 10 80703891 missense probably benign 0.02
V7582:Izumo4 UTSW 10 80703891 missense probably benign 0.02
V7583:Izumo4 UTSW 10 80703891 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGAGTTGGAAGCATGATCAGGCCC -3'
(R):5'- AACGGTCAAGTTCAGGTGCGTAG -3'

Sequencing Primer
(F):5'- GCGCGAGCTGTTGGTTG -3'
(R):5'- GAAGTACATCTTCCCCTGGTACAG -3'
Posted On2013-04-24