Incidental Mutation 'R3954:Me2'
ID308130
Institutional Source Beutler Lab
Gene Symbol Me2
Ensembl Gene ENSMUSG00000024556
Gene Namemalic enzyme 2, NAD(+)-dependent, mitochondrial
SynonymsD030040L20Rik
MMRRC Submission 040831-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R3954 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location73770040-73815392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73781132 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 443 (F443L)
Ref Sequence ENSEMBL: ENSMUSP00000025439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025439]
Predicted Effect probably damaging
Transcript: ENSMUST00000025439
AA Change: F443L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025439
Gene: ENSMUSG00000024556
AA Change: F443L

DomainStartEndE-ValueType
malic 89 270 3.48e-98 SMART
Malic_M 280 535 2.21e-103 SMART
Meta Mutation Damage Score 0.4 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial NAD-dependent malic enzyme, a homotetrameric protein, that catalyzes the oxidative decarboxylation of malate to pyruvate. It had previously been weakly linked to a syndrome known as Friedreich ataxia that has since been shown to be the result of mutation in a completely different gene. Certain single-nucleotide polymorphism haplotypes of this gene have been shown to increase the risk for idiopathic generalized epilepsy. Alternatively spliced transcript variants encoding different isoforms found for this gene. [provided by RefSeq, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,384,389 S118P probably damaging Het
9330159F19Rik A G 10: 29,224,809 K393E possibly damaging Het
Aagab A G 9: 63,619,160 E155G probably damaging Het
Acad11 A G 9: 104,086,152 probably benign Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Ankle2 A G 5: 110,251,675 T633A probably benign Het
Arhgef19 A G 4: 141,256,334 Y726C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
B3galnt2 A G 13: 13,966,454 Q87R probably benign Het
Carmil1 A G 13: 24,013,407 S1349P probably benign Het
Ccdc114 A G 7: 45,941,676 K192E probably damaging Het
Cfap52 C A 11: 67,930,865 V446L probably benign Het
Cgnl1 T C 9: 71,724,663 N469D probably benign Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dlg1 T C 16: 31,858,008 Y792H probably damaging Het
Dusp13 T A 14: 21,740,107 D57V probably damaging Het
Galnt6 A G 15: 100,697,168 V484A possibly damaging Het
Gm13128 A C 4: 144,331,668 M282L probably benign Het
Hbq1a T C 11: 32,300,214 probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igkv4-79 A G 6: 69,043,245 S29P possibly damaging Het
Lamp5 G A 2: 136,061,008 D216N probably damaging Het
Ncam2 G A 16: 81,589,724 V664M probably damaging Het
Ndst4 T C 3: 125,437,905 M41T probably benign Het
Nkx6-3 G T 8: 23,153,726 A48S possibly damaging Het
Ntng2 A G 2: 29,207,535 C305R probably damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Omd A T 13: 49,589,737 I88F probably benign Het
Pi4k2a G A 19: 42,115,899 A367T probably damaging Het
Prph2 T C 17: 46,910,718 F8L probably benign Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Tec T C 5: 72,782,177 probably null Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Vmn1r124 A G 7: 21,260,523 V32A possibly damaging Het
Zc3h13 T A 14: 75,329,738 S921T possibly damaging Het
Other mutations in Me2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Me2 APN 18 73770642 missense probably benign 0.01
IGL00977:Me2 APN 18 73791177 missense probably benign 0.24
IGL01161:Me2 APN 18 73770816 splice site probably benign
IGL02351:Me2 APN 18 73797967 missense probably benign 0.20
IGL02358:Me2 APN 18 73797967 missense probably benign 0.20
IGL02647:Me2 APN 18 73797903 missense probably benign 0.00
IGL03172:Me2 APN 18 73770726 missense probably benign
baako UTSW 18 73797945 missense probably damaging 1.00
first_born UTSW 18 73791128 nonsense probably null
muster UTSW 18 73791844 missense probably benign 0.01
Roundup UTSW 18 73770673 missense probably benign
R0018:Me2 UTSW 18 73791852 missense possibly damaging 0.93
R0018:Me2 UTSW 18 73791852 missense possibly damaging 0.93
R0032:Me2 UTSW 18 73794525 missense probably benign
R0119:Me2 UTSW 18 73770673 missense probably benign
R0136:Me2 UTSW 18 73770673 missense probably benign
R0299:Me2 UTSW 18 73770673 missense probably benign
R0657:Me2 UTSW 18 73770673 missense probably benign
R1597:Me2 UTSW 18 73797945 missense probably damaging 1.00
R1638:Me2 UTSW 18 73773134 missense probably benign 0.03
R1765:Me2 UTSW 18 73791858 missense probably damaging 1.00
R1861:Me2 UTSW 18 73785714 missense probably benign 0.11
R2410:Me2 UTSW 18 73791112 missense probably damaging 0.98
R3422:Me2 UTSW 18 73791194 missense probably damaging 0.99
R3957:Me2 UTSW 18 73781132 missense probably damaging 1.00
R4052:Me2 UTSW 18 73791085 missense probably benign 0.05
R4207:Me2 UTSW 18 73791085 missense probably benign 0.05
R4208:Me2 UTSW 18 73791085 missense probably benign 0.05
R4694:Me2 UTSW 18 73801859 missense probably benign 0.01
R4962:Me2 UTSW 18 73785776 missense probably damaging 1.00
R5527:Me2 UTSW 18 73791116 missense probably damaging 1.00
R6170:Me2 UTSW 18 73785781 missense probably benign 0.07
R6185:Me2 UTSW 18 73791128 nonsense probably null
R6305:Me2 UTSW 18 73791844 missense probably benign 0.01
R6462:Me2 UTSW 18 73775399 missense probably benign 0.17
R7085:Me2 UTSW 18 73781058 missense probably damaging 1.00
R7096:Me2 UTSW 18 73794890 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTCCTAAAGAATTCCATGGACATGTTC -3'
(R):5'- TGCTAGGGTTTAAAGAGAGCCTC -3'

Sequencing Primer
(F):5'- TGGGAATCGAACCAGGTTCTC -3'
(R):5'- GGGTTTAAAGAGAGCCTCATTTCAG -3'
Posted On2015-04-17