Incidental Mutation 'R1888:Tlr4'
ID308149
Institutional Source Beutler Lab
Gene Symbol Tlr4
Ensembl Gene ENSMUSG00000039005
Gene Nametoll-like receptor 4
SynonymsRasl2-8, Lps, lipopolysaccharide response
MMRRC Submission 039909-MU
Accession Numbers

MGI: 96824

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1888 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location66827584-66930284 bp(+) (GRCm38)
Type of Mutationmissense (7112 bp from exon)
DNA Base Change (assembly) T to C at 66841172 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 734 (V734A)
Ref Sequence Ensembl: ENSMUSP00000045770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048096] [ENSMUST00000107365]
PDB Structure
Crystal structure of mouse TLR4 and mouse MD-2 complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/lipid IVa complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/LPS complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000048096
AA Change: V734A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045770
Gene: ENSMUSG00000039005
AA Change: V734A

DomainStartEndE-ValueType
LRR 76 99 7.36e0 SMART
LRR 100 123 1.86e0 SMART
LRR 173 196 8.24e0 SMART
LRR 370 401 4.33e1 SMART
LRR 468 492 2.54e2 SMART
LRR 493 516 1.86e2 SMART
LRR 517 540 1.67e2 SMART
LRR 541 563 1.92e2 SMART
LRRCT 576 626 4.74e-3 SMART
transmembrane domain 636 658 N/A INTRINSIC
TIR 671 816 7.3e-39 SMART
low complexity region 822 833 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107365
SMART Domains Protein: ENSMUSP00000102988
Gene: ENSMUSG00000039005

DomainStartEndE-ValueType
PDB:3VQ2|B 22 86 2e-38 PDB
SCOP:d1m0za_ 27 86 4e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147008
Meta Mutation Damage Score 0.338 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene belongs to the evolutionarily-conserved Toll-like receptor family, whose members are type-1 transmembrane proteins that are involved in innate immunity. Toll-like receptors are characterized by an extracellular leucine-rich repeat domain that functions in ligand recognition and an intracellular toll/interleukin-1 receptor-like domain that is crucial for signal transduction. The receptor encoded by this gene mediates the innate immune response to bacterial lipopolysaccharide, a major component of the outer membrane of Gram-negative bacteria, through synthesis of pro-inflammatory cytokines and chemokines. In addition, this protein can recognize other pathogens from Gram-negative and Gram-positive bacteria as well as viral components. Mice deficient in this gene display a number of immune response-related phenotypes including hyporesponsiveness to bacterial lipopolysaccharide and increased levels of respiratory syncytial virus compared to controls. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous or targeted mutations are hyporesponsive to bacterial lipopolysaccharide and more susceptible to infection by gram negative bacteria. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(2) Spontaneous(6) Chemically induced(2)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,283 K845E possibly damaging Het
4930447C04Rik A G 12: 72,913,256 M80T unknown Het
4930578I06Rik A G 14: 63,986,183 L48P probably damaging Het
Abcc9 A G 6: 142,679,314 S452P probably benign Het
Adgrb2 T C 4: 130,013,626 F1032S probably damaging Het
Adgrf5 T G 17: 43,427,005 H243Q probably null Het
Adgrl4 A G 3: 151,439,277 N21S probably benign Het
Adss A T 1: 177,784,951 Y77* probably null Het
Ahnak A T 19: 9,007,088 D1912V probably damaging Het
Ahnak2 A G 12: 112,773,891 M1249T possibly damaging Het
Akap6 A T 12: 53,142,175 D2124V possibly damaging Het
Ankrd28 A T 14: 31,732,025 probably benign Het
Bbs12 C A 3: 37,320,563 L387I probably damaging Het
BC023105 T C 18: 60,442,499 L248P noncoding transcript Het
Cbwd1 A T 19: 24,955,405 V88D probably damaging Het
Ciita T C 16: 10,511,084 Y411H probably damaging Het
Ckb TCCACCACCA TCCACCA 12: 111,669,645 probably benign Het
Clec9a G A 6: 129,410,286 V35I probably benign Het
Cntn5 T A 9: 9,984,077 Q382L possibly damaging Het
Dock2 A T 11: 34,707,342 I334N probably damaging Het
Dock9 G T 14: 121,625,205 T833K probably benign Het
Drd2 G A 9: 49,402,142 V204I probably benign Het
Fam120a A T 13: 48,885,866 I938N possibly damaging Het
Fndc1 T C 17: 7,771,789 E1025G unknown Het
Fsip2 G A 2: 82,944,160 D64N probably benign Het
Gm12794 T A 4: 101,941,138 V102E probably damaging Het
Gm14496 T A 2: 182,000,196 C553* probably null Het
Gm14685 G T X: 73,127,655 G218C probably damaging Homo
Gm15587 C G 5: 24,367,469 G739A probably benign Het
Gm1966 A T 7: 106,597,423 S2205T noncoding transcript Het
Gm6020 C T 19: 61,183,953 H22Y possibly damaging Het
Hexa A G 9: 59,557,303 T159A probably benign Het
Hmcn1 C G 1: 150,819,500 A218P possibly damaging Het
Hpgds A G 6: 65,138,233 F22S probably damaging Het
Il5ra T A 6: 106,731,913 N289Y probably damaging Het
Ilf2 T C 3: 90,487,460 I400T probably benign Het
Irf2 A T 8: 46,807,353 R107* probably null Het
Kcnk6 T C 7: 29,225,650 I180M probably benign Het
Krtap5-3 G A 7: 142,202,242 G272D probably benign Het
Lrig1 C T 6: 94,654,878 A114T probably benign Het
Lrrc37a A G 11: 103,498,761 V1946A probably benign Het
Lrrc8b T C 5: 105,481,351 V521A probably benign Het
Macf1 T G 4: 123,455,042 I2154L possibly damaging Het
Macf1 C A 4: 123,474,712 E2085D probably benign Het
Maml1 C T 11: 50,266,641 A236T probably benign Het
Mdc1 C A 17: 35,854,225 T1481K probably benign Het
Mecp2 C T X: 74,037,175 A79T probably damaging Homo
Med24 A G 11: 98,707,282 L1189P probably benign Het
Mfap3l T C 8: 60,671,390 V222A possibly damaging Het
Mis18bp1 A G 12: 65,149,328 I554T probably benign Het
Mpped2 T C 2: 106,699,445 I13T probably benign Het
Mthfd1l C A 10: 4,106,528 T948K probably damaging Het
Mtus1 C T 8: 41,084,325 S118N probably damaging Het
Mtx3 A G 13: 92,847,683 E156G probably benign Het
Mybbp1a C T 11: 72,446,037 T565I probably benign Het
Myh2 G A 11: 67,180,850 V498M probably damaging Het
Myo15b G A 11: 115,887,073 G1049S probably damaging Het
Myo1b T A 1: 51,760,403 probably null Het
Ndufa2 T A 18: 36,744,520 M1L probably benign Het
Nipal2 T C 15: 34,625,021 I129M possibly damaging Het
Nt5dc3 A G 10: 86,834,062 N507S possibly damaging Het
Olfr1271 A G 2: 90,265,569 L287P probably damaging Het
Olfr875 T A 9: 37,772,867 D69E possibly damaging Het
Pcdhb17 G A 18: 37,487,385 V743M probably null Het
Pcyt2 A G 11: 120,617,851 M1T probably null Het
Pear1 C A 3: 87,810,575 probably benign Het
Pla2g2d T C 4: 138,775,815 M1T probably null Het
Plekhg6 T C 6: 125,363,343 T685A probably damaging Het
Pxk T C 14: 8,151,540 S452P probably damaging Het
Rab42 A T 4: 132,303,218 D40E probably benign Het
Rapgef6 A C 11: 54,660,828 T836P probably damaging Het
Rtn1 A G 12: 72,236,533 S52P probably benign Het
Serpina3a A G 12: 104,116,103 D45G probably benign Het
Slco6b1 A G 1: 96,922,061 noncoding transcript Het
Smad9 CTTT CTT 3: 54,789,179 probably benign Het
Sntb1 T A 15: 55,749,349 R278* probably null Het
Spice1 T G 16: 44,365,626 S111A probably damaging Het
Stk40 T A 4: 126,125,745 L104Q probably damaging Het
Syk A G 13: 52,640,790 Y520C probably damaging Het
Syngr2 G A 11: 117,813,398 V170M possibly damaging Het
Tcf12 A T 9: 71,858,534 D541E possibly damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem132a T C 19: 10,863,499 E389G probably damaging Het
Tmem150b A G 7: 4,709,045 I112T probably benign Het
Tmod1 C T 4: 46,097,069 R287* silent Het
Trbc1 G A 6: 41,535,636 probably benign Het
Tril A G 6: 53,819,592 L215P probably damaging Het
Trim24 G T 6: 37,957,078 R722L probably damaging Het
Ttn G A 2: 76,792,807 P15429S probably damaging Het
Ttn T A 2: 76,875,958 T2155S probably benign Het
Tubgcp2 A G 7: 139,999,270 V701A probably damaging Het
Tubgcp2 A G 7: 140,006,156 F407L probably damaging Het
Usp45 T C 4: 21,784,811 V188A probably benign Het
Vmn1r30 A C 6: 58,435,490 L119R possibly damaging Het
Washc5 A C 15: 59,359,325 L363R probably damaging Het
Zan T C 5: 137,389,328 T4874A unknown Het
Zfp420 A T 7: 29,874,508 H51L probably damaging Het
Zfp512b C A 2: 181,588,442 R497L probably damaging Het
Zmat4 A G 8: 24,015,161 N208S probably damaging Het
Other mutations in Tlr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Tlr4 APN 4 66840425 missense probably benign 0.01
IGL01343:Tlr4 APN 4 66833887 unclassified probably benign
IGL01669:Tlr4 APN 4 66841267 missense possibly damaging 0.48
IGL01875:Tlr4 APN 4 66839489 missense probably damaging 1.00
IGL02138:Tlr4 APN 4 66840965 missense probably damaging 0.99
IGL02244:Tlr4 APN 4 66834061 unclassified probably null
IGL02793:Tlr4 APN 4 66839444 missense probably damaging 1.00
IGL03269:Tlr4 APN 4 66840796 missense probably damaging 1.00
IGL03288:Tlr4 APN 4 66839753 missense probably damaging 0.99
bugsy UTSW 4 66839254 nonsense probably null
cruyff UTSW 4 66840326 missense probably damaging 1.00
don_knotts UTSW 4 66841172 missense probably damaging 1.00
Guardiola UTSW 4 66839303 missense probably damaging 1.00
Lops UTSW 4 66833880 splice acceptor site probably null
lps3 UTSW 4 66841097 missense probably damaging 1.00
Lps4 UTSW 4 66841142 missense probably damaging 1.00
milquetoast UTSW 4 66839444 missense probably damaging 1.00
R0449:Tlr4 UTSW 4 66839620 missense probably damaging 0.99
R0481:Tlr4 UTSW 4 66827916 missense probably benign 0.05
R0576:Tlr4 UTSW 4 66839495 missense probably benign 0.00
R0827:Tlr4 UTSW 4 66833880 splice site probably null
R1488:Tlr4 UTSW 4 66839549 missense probably damaging 1.00
R1490:Tlr4 UTSW 4 66839374 missense possibly damaging 0.56
R1522:Tlr4 UTSW 4 66839696 missense possibly damaging 0.80
R1616:Tlr4 UTSW 4 66839480 missense probably damaging 1.00
R1681:Tlr4 UTSW 4 66841105 missense probably damaging 1.00
R1738:Tlr4 UTSW 4 66841076 missense probably benign 0.19
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1929:Tlr4 UTSW 4 66839444 missense probably damaging 1.00
R1982:Tlr4 UTSW 4 66841035 missense probably benign 0.40
R1998:Tlr4 UTSW 4 66840470 missense probably damaging 1.00
R2186:Tlr4 UTSW 4 66839983 missense possibly damaging 0.63
R2305:Tlr4 UTSW 4 66840101 missense probably damaging 1.00
R3011:Tlr4 UTSW 4 66839254 nonsense probably null
R3420:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3422:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3818:Tlr4 UTSW 4 66841316 missense probably benign 0.00
R4212:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4213:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4417:Tlr4 UTSW 4 66839303 missense probably damaging 1.00
R4630:Tlr4 UTSW 4 66839240 missense probably benign 0.44
R4735:Tlr4 UTSW 4 66841198 missense probably damaging 1.00
R5191:Tlr4 UTSW 4 66841379 missense probably damaging 0.96
R5613:Tlr4 UTSW 4 66840885 missense possibly damaging 0.94
R5705:Tlr4 UTSW 4 66833980 missense probably damaging 1.00
R5726:Tlr4 UTSW 4 66840415 missense probably benign
R6021:Tlr4 UTSW 4 66840866 missense probably damaging 1.00
R6159:Tlr4 UTSW 4 66839833 missense possibly damaging 0.92
R6227:Tlr4 UTSW 4 66840595 missense probably benign
X0064:Tlr4 UTSW 4 66840140 missense probably damaging 0.99
Z1088:Tlr4 UTSW 4 66929082 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCATTTGTGATCTACTCGAGTC -3'
(R):5'- TCTCCAGAAGATGTGCCTCC -3'

Sequencing Primer
(F):5'- TGTGATCTACTCGAGTCAGAATGAG -3'
(R):5'- AGAAGATGTGCCTCCCCAGAG -3'
Posted OnApr 17, 2015