Incidental Mutation 'R0377:Osbpl7'
ID30817
Institutional Source Beutler Lab
Gene Symbol Osbpl7
Ensembl Gene ENSMUSG00000038534
Gene Nameoxysterol binding protein-like 7
Synonyms
MMRRC Submission 038583-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R0377 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location97050628-97068904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97055934 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 211 (D211G)
Ref Sequence ENSEMBL: ENSMUSP00000126902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090020] [ENSMUST00000168565]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090020
AA Change: D382G

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000087474
Gene: ENSMUSG00000038534
AA Change: D382G

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
low complexity region 138 154 N/A INTRINSIC
PH 174 270 7.76e-11 SMART
low complexity region 533 551 N/A INTRINSIC
Pfam:Oxysterol_BP 599 947 4.6e-135 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154084
Predicted Effect probably damaging
Transcript: ENSMUST00000168565
AA Change: D211G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126902
Gene: ENSMUSG00000038534
AA Change: D211G

DomainStartEndE-ValueType
PH 3 99 7.76e-11 SMART
Pfam:Oxysterol_BP 427 776 8.8e-140 PFAM
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Like most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. Two transcript variants encoding the same isoform have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 C A 11: 94,375,096 V107F possibly damaging Het
Acad11 T A 9: 104,081,692 probably benign Het
Ache G A 5: 137,290,928 E299K possibly damaging Het
Adam5 T C 8: 24,747,541 T618A probably benign Het
Amigo2 T A 15: 97,246,380 T54S possibly damaging Het
Anapc1 A G 2: 128,641,340 probably null Het
Armc4 G A 18: 7,127,415 R933C probably benign Het
Btaf1 A G 19: 36,989,002 K1057E probably benign Het
Cep55 T A 19: 38,071,889 L396* probably null Het
Cic C A 7: 25,285,799 H1157N probably damaging Het
Cntnap5a A T 1: 116,292,529 T690S probably benign Het
D5Ertd579e A T 5: 36,604,567 C1319S probably benign Het
Dnah6 A G 6: 73,121,992 S2027P possibly damaging Het
Dntt G A 19: 41,047,627 W369* probably null Het
Esp18 T A 17: 39,409,944 W27R probably benign Het
Fam227b A T 2: 126,125,000 probably benign Het
Fbxo31 G A 8: 121,559,102 probably benign Het
Gm13547 G A 2: 29,761,791 probably null Het
Gnl2 T A 4: 125,046,382 probably benign Het
Gpx2 G A 12: 76,795,156 Q74* probably null Het
Gucy2c A G 6: 136,750,917 probably null Het
Hoxa5 A T 6: 52,202,646 W250R probably damaging Het
Izumo4 G A 10: 80,702,840 R42H probably damaging Het
Kcnj12 G A 11: 61,069,396 M71I probably benign Het
Kmt2b A T 7: 30,574,193 L2333Q probably damaging Het
Mak T C 13: 41,049,348 E177G probably damaging Het
Map3k7 T A 4: 31,985,731 I218N probably damaging Het
Mark3 T C 12: 111,629,029 L393P probably damaging Het
Msh4 A G 3: 153,896,890 S234P probably benign Het
Mug1 A G 6: 121,857,361 D367G probably benign Het
Mypn A G 10: 63,127,622 probably benign Het
Ncapg T C 5: 45,693,817 V784A probably benign Het
Nutf2 T A 8: 105,878,872 V113D probably damaging Het
Olfr1080 A T 2: 86,553,583 D180E probably damaging Het
Opn3 T C 1: 175,663,694 M258V probably damaging Het
Pcnx C T 12: 81,974,579 probably benign Het
Plekhd1 G A 12: 80,706,436 probably benign Het
Pnpla6 A G 8: 3,541,501 E1165G probably damaging Het
Prkab2 T A 3: 97,662,317 D66E probably benign Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Ptpn23 A T 9: 110,388,132 S885R possibly damaging Het
Rab26 A T 17: 24,530,045 probably benign Het
Rab5a G A 17: 53,500,462 M175I probably benign Het
Rassf9 T A 10: 102,545,649 D297E probably benign Het
Rimbp2 C T 5: 128,803,861 R161Q probably damaging Het
Rtp1 A G 16: 23,431,284 Y133C probably damaging Het
Sdr16c5 G A 4: 4,005,546 L263F probably benign Het
Sec14l1 T G 11: 117,149,140 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spaca1 T C 4: 34,044,267 probably null Het
Stk36 C T 1: 74,612,730 P394L probably benign Het
Stk4 T C 2: 164,096,800 I196T probably damaging Het
Sult1b1 A T 5: 87,517,376 M233K probably damaging Het
Tmem8b C T 4: 43,674,005 T212M probably damaging Het
Tmprss11g A T 5: 86,490,751 F293I probably damaging Het
Tnfsf11 T G 14: 78,299,912 T104P probably benign Het
Trmt2a G A 16: 18,249,703 R80Q possibly damaging Het
Trps1 C A 15: 50,831,778 E324* probably null Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Wdr18 G A 10: 79,967,502 R400H probably benign Het
Wdr78 A G 4: 103,048,259 V775A probably damaging Het
Zfp119b T A 17: 55,938,671 H505L probably damaging Het
Zfp619 T A 7: 39,536,797 C750* probably null Het
Zfr T C 15: 12,160,591 I750T probably benign Het
Other mutations in Osbpl7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Osbpl7 APN 11 97052300 missense probably benign 0.00
IGL02041:Osbpl7 APN 11 97060508 missense probably benign 0.08
IGL02322:Osbpl7 APN 11 97056124 missense probably benign 0.18
IGL02396:Osbpl7 APN 11 97055551 missense probably damaging 1.00
IGL02441:Osbpl7 APN 11 97067702 missense probably damaging 1.00
IGL02668:Osbpl7 APN 11 97067205 missense possibly damaging 0.90
IGL03003:Osbpl7 APN 11 97050695 missense probably benign
R0549:Osbpl7 UTSW 11 97067542 missense probably damaging 1.00
R0848:Osbpl7 UTSW 11 97060524 missense probably damaging 1.00
R0919:Osbpl7 UTSW 11 97056101 missense possibly damaging 0.92
R1845:Osbpl7 UTSW 11 97059128 missense probably damaging 1.00
R2119:Osbpl7 UTSW 11 97056079 missense probably benign 0.02
R2418:Osbpl7 UTSW 11 97059178 missense probably benign 0.00
R2571:Osbpl7 UTSW 11 97054841 missense probably damaging 1.00
R3746:Osbpl7 UTSW 11 97056053 missense probably damaging 1.00
R3747:Osbpl7 UTSW 11 97056053 missense probably damaging 1.00
R3749:Osbpl7 UTSW 11 97056053 missense probably damaging 1.00
R4590:Osbpl7 UTSW 11 97056272 missense probably damaging 1.00
R4602:Osbpl7 UTSW 11 97056269 missense possibly damaging 0.77
R4857:Osbpl7 UTSW 11 97056669 intron probably benign
R4898:Osbpl7 UTSW 11 97060150 missense probably damaging 0.98
R5160:Osbpl7 UTSW 11 97054556 missense probably damaging 1.00
R5292:Osbpl7 UTSW 11 97067953 missense probably benign 0.07
R5685:Osbpl7 UTSW 11 97060277 missense probably damaging 1.00
R5786:Osbpl7 UTSW 11 97065832 missense probably damaging 1.00
R6030:Osbpl7 UTSW 11 97052261 missense probably benign 0.15
R6030:Osbpl7 UTSW 11 97052261 missense probably benign 0.15
R6038:Osbpl7 UTSW 11 97050716 missense probably benign
R6038:Osbpl7 UTSW 11 97050716 missense probably benign
R6239:Osbpl7 UTSW 11 97052824 critical splice donor site probably null
R6715:Osbpl7 UTSW 11 97054599 missense probably damaging 1.00
R6920:Osbpl7 UTSW 11 97050758 missense probably damaging 0.99
X0020:Osbpl7 UTSW 11 97056559 missense probably benign 0.01
X0060:Osbpl7 UTSW 11 97060510 nonsense probably null
X0062:Osbpl7 UTSW 11 97065643 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGCCTGAGCAATCTGTGCTCTCC -3'
(R):5'- GCCAGACAGTCAGACTCCATTTCC -3'

Sequencing Primer
(F):5'- CTCTTCAACTTGGCAGACCT -3'
(R):5'- AGCCCAGAAACTGCGCTG -3'
Posted On2013-04-24