Incidental Mutation 'R3925:Olfr1102'
ID308232
Institutional Source Beutler Lab
Gene Symbol Olfr1102
Ensembl Gene ENSMUSG00000049843
Gene Nameolfactory receptor 1102
SynonymsMOR179-4, GA_x6K02T2Q125-48487992-48488966
MMRRC Submission 040916-MU
Accession Numbers

Ncbi RefSeq: NM_207154.2; MGI: 3030936

Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R3925 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86998398-87003618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87002374 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 135 (Y135C)
Ref Sequence ENSEMBL: ENSMUSP00000149634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055129] [ENSMUST00000214002]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055129
AA Change: Y135C

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000052861
Gene: ENSMUSG00000049843
AA Change: Y135C

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:7tm_4 43 320 8.1e-52 PFAM
Pfam:7TM_GPCR_Srsx 47 322 8.7e-6 PFAM
Pfam:7tm_1 53 302 3.6e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214002
AA Change: Y135C

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.534 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,578,772 T487I possibly damaging Het
Amn T C 12: 111,275,680 V367A possibly damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cfap43 T C 19: 47,797,116 K445R probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Eif4e G A 3: 138,555,437 G164D probably damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Hmcn2 G A 2: 31,453,157 R4565Q probably benign Het
Itgal A T 7: 127,324,537 probably benign Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Ms4a2 A G 19: 11,618,948 M139T probably benign Het
Nr2e3 C T 9: 59,948,433 R213H probably damaging Het
Olfr224 T A 11: 58,566,826 H173L probably benign Het
Olfr664 T A 7: 104,734,189 E58D probably benign Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Pabpc1l T A 2: 164,027,676 probably benign Het
Prim2 A G 1: 33,533,299 L253P probably damaging Het
Pycr1 T C 11: 120,642,135 T100A probably benign Het
Qrfpr T C 3: 36,221,923 N106S possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenoi T A 5: 30,256,088 D107E probably damaging Het
Synrg C T 11: 84,040,899 P1321S probably benign Het
Tcrg-V7 A G 13: 19,178,474 Y111C probably damaging Het
Trp53rkb A G 2: 166,795,472 Y116C probably damaging Het
Usp34 T A 11: 23,343,640 F245I probably benign Het
Utrn C T 10: 12,698,042 V1095I probably benign Het
Xpnpep1 T C 19: 52,991,697 H632R probably damaging Het
Zfp735 T C 11: 73,711,124 I298T probably benign Het
Zfp953 T A 13: 67,347,938 Y13F probably damaging Het
Other mutations in Olfr1102
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:Olfr1102 APN 2 87002923 missense probably benign 0.31
IGL01584:Olfr1102 APN 2 87002151 missense probably benign 0.04
IGL01913:Olfr1102 APN 2 87002820 missense possibly damaging 0.68
IGL02672:Olfr1102 APN 2 87002073 missense probably benign 0.00
R0003:Olfr1102 UTSW 2 87002366 nonsense probably null
R0003:Olfr1102 UTSW 2 87002366 nonsense probably null
R1674:Olfr1102 UTSW 2 87002233 missense probably benign 0.07
R1688:Olfr1102 UTSW 2 87002386 missense probably benign 0.01
R3826:Olfr1102 UTSW 2 87002044 missense probably damaging 0.97
R4023:Olfr1102 UTSW 2 87002922 nonsense probably null
R4730:Olfr1102 UTSW 2 87002166 missense possibly damaging 0.48
R5154:Olfr1102 UTSW 2 87002038 missense probably benign 0.00
R5525:Olfr1102 UTSW 2 87002339 missense possibly damaging 0.95
R5685:Olfr1102 UTSW 2 87002277 missense probably benign 0.02
R5788:Olfr1102 UTSW 2 87002301 missense probably benign 0.01
R6280:Olfr1102 UTSW 2 87002020 missense probably damaging 0.99
R7178:Olfr1102 UTSW 2 87002535 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGTCATCCTTGGATGCCTGC -3'
(R):5'- AGCCTGCACAGTAGAAGAGC -3'

Sequencing Primer
(F):5'- GGATGCCTGCTTTTCTTCAG -3'
(R):5'- TTGATTTAAGTGGGTGTCAGAACAAG -3'
Posted On2015-04-17