Incidental Mutation 'R3925:Qrfpr'
ID308234
Institutional Source Beutler Lab
Gene Symbol Qrfpr
Ensembl Gene ENSMUSG00000058400
Gene Namepyroglutamylated RFamide peptide receptor
SynonymsGpr103, AQ27
MMRRC Submission 040916-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3925 (G1)
Quality Score223
Status Validated
Chromosome3
Chromosomal Location36179424-36222313 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36221923 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 106 (N106S)
Ref Sequence ENSEMBL: ENSMUSP00000088768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091227] [ENSMUST00000197447]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091227
AA Change: N106S

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000088768
Gene: ENSMUSG00000058400
AA Change: N106S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 56 347 3.6e-8 PFAM
Pfam:7tm_1 62 332 4.5e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197275
Predicted Effect probably benign
Transcript: ENSMUST00000197447
AA Change: N106S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000143773
Gene: ENSMUSG00000058400
AA Change: N106S

DomainStartEndE-ValueType
low complexity region 40 61 N/A INTRINSIC
Pfam:7tm_1 62 229 1.1e-35 PFAM
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (30/31)
MGI Phenotype PHENOTYPE: Mice homozygous for a mutation diisplay kyphosis with abnormal vertebrae morphology and development including osteopenia of the vertebrae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,578,772 T487I possibly damaging Het
Amn T C 12: 111,275,680 V367A possibly damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cfap43 T C 19: 47,797,116 K445R probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Eif4e G A 3: 138,555,437 G164D probably damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Hmcn2 G A 2: 31,453,157 R4565Q probably benign Het
Itgal A T 7: 127,324,537 probably benign Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Ms4a2 A G 19: 11,618,948 M139T probably benign Het
Nr2e3 C T 9: 59,948,433 R213H probably damaging Het
Olfr1102 A G 2: 87,002,374 Y135C possibly damaging Het
Olfr224 T A 11: 58,566,826 H173L probably benign Het
Olfr664 T A 7: 104,734,189 E58D probably benign Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Pabpc1l T A 2: 164,027,676 probably benign Het
Prim2 A G 1: 33,533,299 L253P probably damaging Het
Pycr1 T C 11: 120,642,135 T100A probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenoi T A 5: 30,256,088 D107E probably damaging Het
Synrg C T 11: 84,040,899 P1321S probably benign Het
Tcrg-V7 A G 13: 19,178,474 Y111C probably damaging Het
Trp53rkb A G 2: 166,795,472 Y116C probably damaging Het
Usp34 T A 11: 23,343,640 F245I probably benign Het
Utrn C T 10: 12,698,042 V1095I probably benign Het
Xpnpep1 T C 19: 52,991,697 H632R probably damaging Het
Zfp735 T C 11: 73,711,124 I298T probably benign Het
Zfp953 T A 13: 67,347,938 Y13F probably damaging Het
Other mutations in Qrfpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Qrfpr APN 3 36181051 splice site probably null
IGL02274:Qrfpr APN 3 36222136 missense probably damaging 0.98
R0382:Qrfpr UTSW 3 36180969 missense possibly damaging 0.73
R0398:Qrfpr UTSW 3 36181052 splice site probably benign
R0631:Qrfpr UTSW 3 36221989 missense probably damaging 1.00
R0690:Qrfpr UTSW 3 36189559 missense probably damaging 1.00
R1222:Qrfpr UTSW 3 36180095 missense probably damaging 1.00
R1413:Qrfpr UTSW 3 36182660 missense possibly damaging 0.92
R1418:Qrfpr UTSW 3 36180095 missense probably damaging 1.00
R1500:Qrfpr UTSW 3 36182580 missense probably damaging 1.00
R2037:Qrfpr UTSW 3 36182657 missense probably damaging 0.99
R3924:Qrfpr UTSW 3 36221923 missense possibly damaging 0.71
R3966:Qrfpr UTSW 3 36181000 missense possibly damaging 0.73
R4298:Qrfpr UTSW 3 36189554 missense probably damaging 1.00
R4751:Qrfpr UTSW 3 36182622 missense possibly damaging 0.67
R4760:Qrfpr UTSW 3 36221924 missense probably benign 0.34
R4989:Qrfpr UTSW 3 36222136 missense probably damaging 0.98
R5548:Qrfpr UTSW 3 36221926 missense possibly damaging 0.84
R5607:Qrfpr UTSW 3 36180965 missense possibly damaging 0.55
R5608:Qrfpr UTSW 3 36180965 missense possibly damaging 0.55
R6027:Qrfpr UTSW 3 36222038 missense probably benign 0.44
R6115:Qrfpr UTSW 3 36182593 missense possibly damaging 0.51
R6546:Qrfpr UTSW 3 36180265 missense probably damaging 1.00
R6714:Qrfpr UTSW 3 36180256 missense possibly damaging 0.81
R7080:Qrfpr UTSW 3 36180049 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GGCATTTTCAAGAAGGGCACAG -3'
(R):5'- ATTCATCGCTATGGGCTGC -3'

Sequencing Primer
(F):5'- GGCACAGGATTCAATTCGAC -3'
(R):5'- AAACTGGCCTTTGCGCTG -3'
Posted On2015-04-17