Incidental Mutation 'R3925:Eif4e'
ID308236
Institutional Source Beutler Lab
Gene Symbol Eif4e
Ensembl Gene ENSMUSG00000028156
Gene Nameeukaryotic translation initiation factor 4E
SynonymsIf4e, eIF-4E
MMRRC Submission 040916-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R3925 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location138526179-138559696 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 138555437 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 164 (G164D)
Ref Sequence ENSEMBL: ENSMUSP00000143772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029803] [ENSMUST00000196990] [ENSMUST00000200020] [ENSMUST00000200100] [ENSMUST00000200239]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029803
AA Change: G196D

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029803
Gene: ENSMUSG00000028156
AA Change: G196D

DomainStartEndE-ValueType
low complexity region 3 23 N/A INTRINSIC
Pfam:IF4E 38 199 8.7e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196990
AA Change: G111D

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143104
Gene: ENSMUSG00000028156
AA Change: G111D

DomainStartEndE-ValueType
Pfam:IF4E 1 115 1.4e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198252
Predicted Effect probably benign
Transcript: ENSMUST00000200020
SMART Domains Protein: ENSMUSP00000143690
Gene: ENSMUSG00000028156

DomainStartEndE-ValueType
low complexity region 3 23 N/A INTRINSIC
Pfam:IF4E 38 183 1.9e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200100
AA Change: G164D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143772
Gene: ENSMUSG00000028156
AA Change: G164D

DomainStartEndE-ValueType
low complexity region 3 23 N/A INTRINSIC
Pfam:IF4E 31 167 3.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200239
SMART Domains Protein: ENSMUSP00000143481
Gene: ENSMUSG00000028156

DomainStartEndE-ValueType
low complexity region 3 23 N/A INTRINSIC
Pfam:IF4E 38 79 5.4e-9 PFAM
Meta Mutation Damage Score 0.406 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: This gene encodes a component of the eukaryotic translation initiation factor 4F complex, which recognizes the 7-methylguanosine cap structure at the 5' end of messenger RNAs. The encoded protein aids in translation initiation by recruiting ribosomes to the 5'-cap structure. Association of this protein with the 4F complex is the rate-limiting step in translation initiation. This gene acts as a proto-oncogene, and its expression and activation is associated with transformation and tumorigenesis. It has also been associated with autism spectrum disorders. Consistently, knockout of this gene results in increased translation of neuroligins, postsynaptic proteins linked to autism spectrum disorders. Pseudogenes of this gene are found on other chromosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit resistance to developing prostate intraepithelial neoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,578,772 T487I possibly damaging Het
Amn T C 12: 111,275,680 V367A possibly damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cfap43 T C 19: 47,797,116 K445R probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Eno1 T C 4: 150,239,568 probably null Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Hmcn2 G A 2: 31,453,157 R4565Q probably benign Het
Itgal A T 7: 127,324,537 probably benign Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Ms4a2 A G 19: 11,618,948 M139T probably benign Het
Nr2e3 C T 9: 59,948,433 R213H probably damaging Het
Olfr1102 A G 2: 87,002,374 Y135C possibly damaging Het
Olfr224 T A 11: 58,566,826 H173L probably benign Het
Olfr664 T A 7: 104,734,189 E58D probably benign Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Pabpc1l T A 2: 164,027,676 probably benign Het
Prim2 A G 1: 33,533,299 L253P probably damaging Het
Pycr1 T C 11: 120,642,135 T100A probably benign Het
Qrfpr T C 3: 36,221,923 N106S possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenoi T A 5: 30,256,088 D107E probably damaging Het
Synrg C T 11: 84,040,899 P1321S probably benign Het
Tcrg-V7 A G 13: 19,178,474 Y111C probably damaging Het
Trp53rkb A G 2: 166,795,472 Y116C probably damaging Het
Usp34 T A 11: 23,343,640 F245I probably benign Het
Utrn C T 10: 12,698,042 V1095I probably benign Het
Xpnpep1 T C 19: 52,991,697 H632R probably damaging Het
Zfp735 T C 11: 73,711,124 I298T probably benign Het
Zfp953 T A 13: 67,347,938 Y13F probably damaging Het
Other mutations in Eif4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Eif4e APN 3 138547651 splice site probably benign
IGL03328:Eif4e APN 3 138553727 intron probably benign
R1398:Eif4e UTSW 3 138546375 missense probably damaging 0.99
R2010:Eif4e UTSW 3 138555458 missense probably benign 0.08
R6026:Eif4e UTSW 3 138550900 missense probably damaging 1.00
R7038:Eif4e UTSW 3 138527182 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTCTGGCTGTGAAAGTAAAGAC -3'
(R):5'- GGATGGAATCAACTTCAGTGC -3'

Sequencing Primer
(F):5'- CGACTTGCATTGCTAATGTA -3'
(R):5'- GATGGAATCAACTTCAGTGCAGTCC -3'
Posted On2015-04-17