Incidental Mutation 'R3925:Eno1'
ID308237
Institutional Source Beutler Lab
Gene Symbol Eno1
Ensembl Gene ENSMUSG00000063524
Gene Nameenolase 1, alpha non-neuron
Synonymsalpha-enolase, 2-phospho-D-glycerate hydrolase, Eno-1, MBP-1, c-Myc promoter binding protein
MMRRC Submission 040916-MU
Accession Numbers

Genbank: NM_023119

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3925 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location150236721-150248879 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 150239568 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080149] [ENSMUST00000080926] [ENSMUST00000133839] [ENSMUST00000141931] [ENSMUST00000150175]
Predicted Effect probably benign
Transcript: ENSMUST00000080149
SMART Domains Protein: ENSMUSP00000079045
Gene: ENSMUSG00000063524

DomainStartEndE-ValueType
Enolase_N 1 66 2.91e-6 SMART
Enolase_C 74 363 1.22e-207 SMART
Predicted Effect probably null
Transcript: ENSMUST00000080926
SMART Domains Protein: ENSMUSP00000079727
Gene: ENSMUSG00000063524

DomainStartEndE-ValueType
Enolase_N 3 134 4.75e-91 SMART
Enolase_C 142 431 1.22e-207 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130632
Predicted Effect probably null
Transcript: ENSMUST00000133839
SMART Domains Protein: ENSMUSP00000114361
Gene: ENSMUSG00000063524

DomainStartEndE-ValueType
Enolase_N 3 134 7.66e-86 SMART
Enolase_C 142 221 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135063
Predicted Effect probably null
Transcript: ENSMUST00000141931
SMART Domains Protein: ENSMUSP00000120059
Gene: ENSMUSG00000063524

DomainStartEndE-ValueType
Enolase_N 3 67 6.31e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148605
Predicted Effect probably null
Transcript: ENSMUST00000150175
SMART Domains Protein: ENSMUSP00000123695
Gene: ENSMUSG00000063524

DomainStartEndE-ValueType
Enolase_N 3 119 2.31e-71 SMART
Meta Mutation Damage Score 0.456 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (30/31)
MGI Phenotype PHENOTYPE: Homozygous animals exhibit growth arrest and embryonic lethality at approximately E6.5. [provided by MGI curators]
Allele List at MGI

All alleles(59) : Targeted, knock-out(1) Gene trapped(58)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,578,772 T487I possibly damaging Het
Amn T C 12: 111,275,680 V367A possibly damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cfap43 T C 19: 47,797,116 K445R probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Eif4e G A 3: 138,555,437 G164D probably damaging Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Hmcn2 G A 2: 31,453,157 R4565Q probably benign Het
Itgal A T 7: 127,324,537 probably benign Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Ms4a2 A G 19: 11,618,948 M139T probably benign Het
Nr2e3 C T 9: 59,948,433 R213H probably damaging Het
Olfr1102 A G 2: 87,002,374 Y135C possibly damaging Het
Olfr224 T A 11: 58,566,826 H173L probably benign Het
Olfr664 T A 7: 104,734,189 E58D probably benign Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Pabpc1l T A 2: 164,027,676 probably benign Het
Prim2 A G 1: 33,533,299 L253P probably damaging Het
Pycr1 T C 11: 120,642,135 T100A probably benign Het
Qrfpr T C 3: 36,221,923 N106S possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenoi T A 5: 30,256,088 D107E probably damaging Het
Synrg C T 11: 84,040,899 P1321S probably benign Het
Tcrg-V7 A G 13: 19,178,474 Y111C probably damaging Het
Trp53rkb A G 2: 166,795,472 Y116C probably damaging Het
Usp34 T A 11: 23,343,640 F245I probably benign Het
Utrn C T 10: 12,698,042 V1095I probably benign Het
Xpnpep1 T C 19: 52,991,697 H632R probably damaging Het
Zfp735 T C 11: 73,711,124 I298T probably benign Het
Zfp953 T A 13: 67,347,938 Y13F probably damaging Het
Other mutations in Eno1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01767:Eno1 APN 4 150246710 missense probably benign 0.03
IGL01992:Eno1 APN 4 150239536 missense probably damaging 1.00
IGL03114:Eno1 APN 4 150241126 missense probably benign 0.01
IGL03133:Eno1 APN 4 150245344 unclassified probably benign
B5639:Eno1 UTSW 4 150245112 unclassified probably benign
R1387:Eno1 UTSW 4 150248133 unclassified probably benign
R1957:Eno1 UTSW 4 150246775 unclassified probably null
R3835:Eno1 UTSW 4 150246662 missense probably benign 0.08
R4178:Eno1 UTSW 4 150244033 missense possibly damaging 0.94
R5577:Eno1 UTSW 4 150246610 nonsense probably null
R5790:Eno1 UTSW 4 150245253 missense probably benign 0.01
R6369:Eno1 UTSW 4 150239568 critical splice donor site probably null
R6377:Eno1 UTSW 4 150248552 missense possibly damaging 0.78
R7305:Eno1 UTSW 4 150245339 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCCCATTTGGTACCTGTC -3'
(R):5'- AATTTGGAACTTGCCCTCCC -3'

Sequencing Primer
(F):5'- ATTTGGTACCTGTCAAGTCCAG -3'
(R):5'- CTTACTTCCCCGTCCCAGTGAAC -3'
Posted On2015-04-17