Incidental Mutation 'R3925:Selenoi'
ID308238
Institutional Source Beutler Lab
Gene Symbol Selenoi
Ensembl Gene ENSMUSG00000075703
Gene Nameselenoprotein I
Synonyms4933402G07Rik, Ept1, C79563, D5Wsu178e
MMRRC Submission 040916-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.887) question?
Stock #R3925 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location30232581-30272427 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30256088 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 107 (D107E)
Ref Sequence ENSEMBL: ENSMUSP00000118368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000132404] [ENSMUST00000145167] [ENSMUST00000145858]
Predicted Effect probably damaging
Transcript: ENSMUST00000132404
AA Change: D82E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117343
Gene: ENSMUSG00000075703
AA Change: D82E

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 46 188 1.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138001
Predicted Effect probably damaging
Transcript: ENSMUST00000145167
AA Change: D107E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118368
Gene: ENSMUSG00000075703
AA Change: D107E

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 48 129 1.8e-16 PFAM
low complexity region 151 167 N/A INTRINSIC
low complexity region 323 339 N/A INTRINSIC
low complexity region 346 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145858
Meta Mutation Damage Score 0.0268 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: The multi-pass transmembrane protein encoded by this gene belongs to the CDP-alcohol phosphatidyltransferase class-I family. It catalyzes the transfer of phosphoethanolamine from CDP-ethanolamine to diacylglycerol to produce phosphatidylethanolamine, which is involved in the formation and maintenance of vesicular membranes, regulation of lipid metabolism, and protein folding. This protein is a selenoprotein, containing the rare selenocysteine (Sec) amino acid at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,578,772 T487I possibly damaging Het
Amn T C 12: 111,275,680 V367A possibly damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cfap43 T C 19: 47,797,116 K445R probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Eif4e G A 3: 138,555,437 G164D probably damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Hmcn2 G A 2: 31,453,157 R4565Q probably benign Het
Itgal A T 7: 127,324,537 probably benign Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Ms4a2 A G 19: 11,618,948 M139T probably benign Het
Nr2e3 C T 9: 59,948,433 R213H probably damaging Het
Olfr1102 A G 2: 87,002,374 Y135C possibly damaging Het
Olfr224 T A 11: 58,566,826 H173L probably benign Het
Olfr664 T A 7: 104,734,189 E58D probably benign Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Pabpc1l T A 2: 164,027,676 probably benign Het
Prim2 A G 1: 33,533,299 L253P probably damaging Het
Pycr1 T C 11: 120,642,135 T100A probably benign Het
Qrfpr T C 3: 36,221,923 N106S possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Synrg C T 11: 84,040,899 P1321S probably benign Het
Tcrg-V7 A G 13: 19,178,474 Y111C probably damaging Het
Trp53rkb A G 2: 166,795,472 Y116C probably damaging Het
Usp34 T A 11: 23,343,640 F245I probably benign Het
Utrn C T 10: 12,698,042 V1095I probably benign Het
Xpnpep1 T C 19: 52,991,697 H632R probably damaging Het
Zfp735 T C 11: 73,711,124 I298T probably benign Het
Zfp953 T A 13: 67,347,938 Y13F probably damaging Het
Other mutations in Selenoi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01537:Selenoi APN 5 30256224 missense probably damaging 0.97
IGL01645:Selenoi APN 5 30257823 unclassified probably benign
IGL03136:Selenoi APN 5 30257727 missense probably damaging 1.00
IGL03232:Selenoi APN 5 30256261 missense probably damaging 1.00
R0506:Selenoi UTSW 5 30266956 missense probably benign 0.00
R1750:Selenoi UTSW 5 30257773 missense probably benign 0.32
R3767:Selenoi UTSW 5 30256189 missense probably damaging 1.00
R4540:Selenoi UTSW 5 30256087 missense probably damaging 1.00
R4797:Selenoi UTSW 5 30252742 missense probably damaging 1.00
R7461:Selenoi UTSW 5 30266928 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AGAGCTTGAGAGTTCGTGCC -3'
(R):5'- TCTCCCAGTGAGACAGGATAAAAG -3'

Sequencing Primer
(F):5'- AGCTCCTGGGAATTCAACG -3'
(R):5'- CCCAGTGAGACAGGATAAAAGAAAAC -3'
Posted On2015-04-17