Incidental Mutation 'R3925:Itgal'
ID308242
Institutional Source Beutler Lab
Gene Symbol Itgal
Ensembl Gene ENSMUSG00000030830
Gene Nameintegrin alpha L
SynonymsLFA-1, Ly-21, Cd11a, Ly-15
MMRRC Submission 040916-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R3925 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127296260-127335138 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 127324537 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106306] [ENSMUST00000117762] [ENSMUST00000118405] [ENSMUST00000120857] [ENSMUST00000170971]
Predicted Effect probably benign
Transcript: ENSMUST00000106306
SMART Domains Protein: ENSMUSP00000101913
Gene: ENSMUSG00000030830

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1043 1059 N/A INTRINSIC
transmembrane domain 1087 1109 N/A INTRINSIC
Pfam:Integrin_alpha 1110 1124 5.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117762
SMART Domains Protein: ENSMUSP00000113946
Gene: ENSMUSG00000030830

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1042 1058 N/A INTRINSIC
transmembrane domain 1086 1108 N/A INTRINSIC
Pfam:Integrin_alpha 1109 1123 5.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118405
SMART Domains Protein: ENSMUSP00000112591
Gene: ENSMUSG00000030830

DomainStartEndE-ValueType
Int_alpha 2 54 4.21e-3 SMART
Int_alpha 58 113 9.6e-7 SMART
Int_alpha 119 172 3.58e-15 SMART
Int_alpha 179 228 1.28e1 SMART
low complexity region 646 662 N/A INTRINSIC
transmembrane domain 690 712 N/A INTRINSIC
Pfam:Integrin_alpha 713 727 2.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120857
SMART Domains Protein: ENSMUSP00000113396
Gene: ENSMUSG00000030830

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1042 1058 N/A INTRINSIC
transmembrane domain 1086 1108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170971
SMART Domains Protein: ENSMUSP00000131847
Gene: ENSMUSG00000030830

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1042 1058 N/A INTRINSIC
transmembrane domain 1086 1108 N/A INTRINSIC
Pfam:Integrin_alpha 1109 1123 1.2e-6 PFAM
Meta Mutation Damage Score 0.1056 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ITGAL encodes the integrin alpha L chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form the integrin lymphocyte function-associated antigen-1 (LFA-1), which is expressed on all leukocytes. LFA-1 plays a central role in leukocyte intercellular adhesion through interactions with its ligands, ICAMs 1-3 (intercellular adhesion molecules 1 through 3), and also functions in lymphocyte costimulatory signaling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mutations of this gene lead to increased leukocyte cell number, alter T cell activation, leukocyte migration and adhesion, spleen and lymph node morphology, and may affect humoral immune responses, metastatic potential, and susceptibility to endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,578,772 T487I possibly damaging Het
Amn T C 12: 111,275,680 V367A possibly damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cfap43 T C 19: 47,797,116 K445R probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Eif4e G A 3: 138,555,437 G164D probably damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Hmcn2 G A 2: 31,453,157 R4565Q probably benign Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Ms4a2 A G 19: 11,618,948 M139T probably benign Het
Nr2e3 C T 9: 59,948,433 R213H probably damaging Het
Olfr1102 A G 2: 87,002,374 Y135C possibly damaging Het
Olfr224 T A 11: 58,566,826 H173L probably benign Het
Olfr664 T A 7: 104,734,189 E58D probably benign Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Pabpc1l T A 2: 164,027,676 probably benign Het
Prim2 A G 1: 33,533,299 L253P probably damaging Het
Pycr1 T C 11: 120,642,135 T100A probably benign Het
Qrfpr T C 3: 36,221,923 N106S possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenoi T A 5: 30,256,088 D107E probably damaging Het
Synrg C T 11: 84,040,899 P1321S probably benign Het
Tcrg-V7 A G 13: 19,178,474 Y111C probably damaging Het
Trp53rkb A G 2: 166,795,472 Y116C probably damaging Het
Usp34 T A 11: 23,343,640 F245I probably benign Het
Utrn C T 10: 12,698,042 V1095I probably benign Het
Xpnpep1 T C 19: 52,991,697 H632R probably damaging Het
Zfp735 T C 11: 73,711,124 I298T probably benign Het
Zfp953 T A 13: 67,347,938 Y13F probably damaging Het
Other mutations in Itgal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Itgal APN 7 127302011 missense probably damaging 0.99
IGL01300:Itgal APN 7 127314118 missense probably damaging 1.00
IGL01345:Itgal APN 7 127300956 missense possibly damaging 0.56
IGL01826:Itgal APN 7 127302146 missense probably benign 0.16
IGL02202:Itgal APN 7 127330179 nonsense probably null
IGL02212:Itgal APN 7 127300980 missense probably benign 0.00
IGL02513:Itgal APN 7 127328672 missense possibly damaging 0.78
IGL02608:Itgal APN 7 127310244 missense probably damaging 1.00
IGL02946:Itgal APN 7 127314368 missense probably damaging 0.99
sunglow UTSW 7 127328747 missense probably null 0.89
R0069:Itgal UTSW 7 127310331 missense probably benign 0.44
R0069:Itgal UTSW 7 127310331 missense probably benign 0.44
R0107:Itgal UTSW 7 127328559 splice site probably benign
R0331:Itgal UTSW 7 127306681 unclassified probably null
R0350:Itgal UTSW 7 127322081 missense probably damaging 1.00
R0380:Itgal UTSW 7 127310751 nonsense probably null
R0537:Itgal UTSW 7 127311273 missense possibly damaging 0.61
R0546:Itgal UTSW 7 127310314 missense probably benign 0.00
R0594:Itgal UTSW 7 127314060 missense probably damaging 1.00
R1167:Itgal UTSW 7 127300939 missense probably damaging 1.00
R1377:Itgal UTSW 7 127321917 missense probably damaging 1.00
R1575:Itgal UTSW 7 127300888 critical splice acceptor site probably null
R1690:Itgal UTSW 7 127302117 missense possibly damaging 0.56
R1693:Itgal UTSW 7 127305281 missense probably damaging 1.00
R1702:Itgal UTSW 7 127305025 missense probably benign 0.00
R1720:Itgal UTSW 7 127306927 missense probably benign 0.00
R1774:Itgal UTSW 7 127309622 critical splice donor site probably null
R1824:Itgal UTSW 7 127314060 missense probably damaging 1.00
R1878:Itgal UTSW 7 127310671 missense probably benign 0.44
R1951:Itgal UTSW 7 127330145 missense probably damaging 1.00
R2265:Itgal UTSW 7 127306701 missense possibly damaging 0.63
R2267:Itgal UTSW 7 127306701 missense possibly damaging 0.63
R2269:Itgal UTSW 7 127306701 missense possibly damaging 0.63
R2276:Itgal UTSW 7 127328747 missense probably null 0.89
R2570:Itgal UTSW 7 127314096 missense probably damaging 1.00
R4225:Itgal UTSW 7 127305312 missense probably damaging 1.00
R4377:Itgal UTSW 7 127328281 missense probably benign 0.00
R4466:Itgal UTSW 7 127328512 missense possibly damaging 0.93
R4579:Itgal UTSW 7 127305294 missense possibly damaging 0.83
R4656:Itgal UTSW 7 127322553 missense probably damaging 1.00
R4771:Itgal UTSW 7 127328233 missense probably damaging 1.00
R5012:Itgal UTSW 7 127299630 critical splice donor site probably null
R5328:Itgal UTSW 7 127311675 critical splice donor site probably null
R5365:Itgal UTSW 7 127305350 missense probably damaging 0.98
R5579:Itgal UTSW 7 127306929 missense probably benign 0.10
R5849:Itgal UTSW 7 127317320 missense probably benign 0.27
R5955:Itgal UTSW 7 127304989 missense possibly damaging 0.82
R6254:Itgal UTSW 7 127325203 missense probably damaging 1.00
R6269:Itgal UTSW 7 127330217 missense probably null 1.00
R6520:Itgal UTSW 7 127330331 missense probably benign 0.01
R6541:Itgal UTSW 7 127311562 missense probably damaging 0.99
R7049:Itgal UTSW 7 127296401 unclassified probably benign
R7168:Itgal UTSW 7 127330213 missense probably benign
R7419:Itgal UTSW 7 127306875 missense probably benign 0.01
R7424:Itgal UTSW 7 127317365 missense probably benign 0.00
R7454:Itgal UTSW 7 127327764 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTAGCAATGGACTCACAGTATG -3'
(R):5'- GCAGCTCTGTATACTGTCCC -3'

Sequencing Primer
(F):5'- TGGGTTCAGACAATCCACTG -3'
(R):5'- TTCCCAGAACCAGGGTCTC -3'
Posted On2015-04-17