Incidental Mutation 'R3925:Ms4a2'
ID308257
Institutional Source Beutler Lab
Gene Symbol Ms4a2
Ensembl Gene ENSMUSG00000024680
Gene Namemembrane-spanning 4-domains, subfamily A, member 2
SynonymsFcrbeta, Fce1b, FcRB, Fcer1b
MMRRC Submission 040916-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R3925 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location11615523-11623719 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11618948 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 139 (M139T)
Ref Sequence ENSEMBL: ENSMUSP00000127373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025583] [ENSMUST00000164792] [ENSMUST00000186978] [ENSMUST00000189641]
Predicted Effect probably benign
Transcript: ENSMUST00000025583
SMART Domains Protein: ENSMUSP00000025583
Gene: ENSMUSG00000024680

DomainStartEndE-ValueType
Pfam:CD20 52 121 4e-20 PFAM
transmembrane domain 134 156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164792
AA Change: M139T

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000127373
Gene: ENSMUSG00000024680
AA Change: M139T

DomainStartEndE-ValueType
Pfam:CD20 52 195 6e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186413
Predicted Effect probably benign
Transcript: ENSMUST00000186978
SMART Domains Protein: ENSMUSP00000140628
Gene: ENSMUSG00000024680

DomainStartEndE-ValueType
transmembrane domain 50 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189641
SMART Domains Protein: ENSMUSP00000139841
Gene: ENSMUSG00000024680

DomainStartEndE-ValueType
Pfam:CD20 52 120 2.1e-20 PFAM
transmembrane domain 140 162 N/A INTRINSIC
Meta Mutation Damage Score 0.0552 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: This gene encodes a member of the membrane-spanning 4A family. The encoded protein is the beta subunit of the high affinity IgE receptor and is localized to the membrane. The encoded protein is required for full activation of mast cells, including the release of histamine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous null mice display decreased susceptibility to passive cutaneous anaphylaxis and abnormal mast cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,578,772 T487I possibly damaging Het
Amn T C 12: 111,275,680 V367A possibly damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cfap43 T C 19: 47,797,116 K445R probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Eif4e G A 3: 138,555,437 G164D probably damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Hmcn2 G A 2: 31,453,157 R4565Q probably benign Het
Itgal A T 7: 127,324,537 probably benign Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Nr2e3 C T 9: 59,948,433 R213H probably damaging Het
Olfr1102 A G 2: 87,002,374 Y135C possibly damaging Het
Olfr224 T A 11: 58,566,826 H173L probably benign Het
Olfr664 T A 7: 104,734,189 E58D probably benign Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Pabpc1l T A 2: 164,027,676 probably benign Het
Prim2 A G 1: 33,533,299 L253P probably damaging Het
Pycr1 T C 11: 120,642,135 T100A probably benign Het
Qrfpr T C 3: 36,221,923 N106S possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenoi T A 5: 30,256,088 D107E probably damaging Het
Synrg C T 11: 84,040,899 P1321S probably benign Het
Tcrg-V7 A G 13: 19,178,474 Y111C probably damaging Het
Trp53rkb A G 2: 166,795,472 Y116C probably damaging Het
Usp34 T A 11: 23,343,640 F245I probably benign Het
Utrn C T 10: 12,698,042 V1095I probably benign Het
Xpnpep1 T C 19: 52,991,697 H632R probably damaging Het
Zfp735 T C 11: 73,711,124 I298T probably benign Het
Zfp953 T A 13: 67,347,938 Y13F probably damaging Het
Other mutations in Ms4a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4887:Ms4a2 UTSW 19 11618429 missense possibly damaging 0.69
R6220:Ms4a2 UTSW 19 11617563 missense probably damaging 0.98
R6666:Ms4a2 UTSW 19 11618423 missense probably benign 0.31
R6804:Ms4a2 UTSW 19 11617535 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTAAGGAATGTGGCCAGG -3'
(R):5'- CCCTATTTAACTGGGGTTTGGAAC -3'

Sequencing Primer
(F):5'- GGAGTAAGACCATTACCTCCTTAG -3'
(R):5'- CCAGTTTTGAGTTACTATACAGGACC -3'
Posted On2015-04-17