Incidental Mutation 'R3926:Tmcc1'
ID308282
Institutional Source Beutler Lab
Gene Symbol Tmcc1
Ensembl Gene ENSMUSG00000030126
Gene Nametransmembrane and coiled coil domains 1
Synonyms
MMRRC Submission 040821-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R3926 (G1)
Quality Score216
Status Validated
Chromosome6
Chromosomal Location116018611-116193486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116042913 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 166 (D166G)
Ref Sequence ENSEMBL: ENSMUSP00000134455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088896] [ENSMUST00000172510] [ENSMUST00000173110] [ENSMUST00000173140] [ENSMUST00000173548] [ENSMUST00000204353]
Predicted Effect unknown
Transcript: ENSMUST00000032222
AA Change: D526G
SMART Domains Protein: ENSMUSP00000032222
Gene: ENSMUSG00000030126
AA Change: D526G

DomainStartEndE-ValueType
low complexity region 153 164 N/A INTRINSIC
Pfam:Tmemb_cc2 268 677 9.7e-170 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000088896
AA Change: D486G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000086285
Gene: ENSMUSG00000030126
AA Change: D486G

DomainStartEndE-ValueType
low complexity region 156 167 N/A INTRINSIC
Pfam:Tmemb_cc2 227 636 2.3e-170 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172510
AA Change: D166G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133665
Gene: ENSMUSG00000030126
AA Change: D166G

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 1 188 6.5e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172909
SMART Domains Protein: ENSMUSP00000134407
Gene: ENSMUSG00000030126

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173110
SMART Domains Protein: ENSMUSP00000133794
Gene: ENSMUSG00000030126

DomainStartEndE-ValueType
low complexity region 156 167 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173140
AA Change: D166G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134455
Gene: ENSMUSG00000030126
AA Change: D166G

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 1 79 6.1e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173548
AA Change: D307G

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145456
Gene: ENSMUSG00000030126
AA Change: D307G

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 48 457 1.5e-167 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204353
AA Change: D311G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144971
Gene: ENSMUSG00000030126
AA Change: D311G

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 52 461 8.3e-171 PFAM
Meta Mutation Damage Score 0.4 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Arfgap2 C T 2: 91,274,805 R405W probably damaging Het
Asb14 T C 14: 26,897,738 I48T possibly damaging Het
Astn1 A T 1: 158,579,657 I559F possibly damaging Het
Atg7 C T 6: 114,673,678 T83M possibly damaging Het
Bco1 T C 8: 117,127,472 S379P probably benign Het
Bst1 T C 5: 43,840,454 V265A possibly damaging Het
Car11 T C 7: 45,700,491 F45L probably benign Het
Cdkl2 T C 5: 92,033,139 I214V possibly damaging Het
Cluap1 T A 16: 3,911,534 S141T probably damaging Het
Col11a1 C T 3: 114,090,124 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Corin T G 5: 72,372,130 D294A probably damaging Het
Crct1 C A 3: 93,014,707 probably benign Het
Ddx41 A G 13: 55,531,270 L559P probably damaging Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dennd1b A G 1: 139,143,959 N397D probably benign Het
Evc2 T A 5: 37,383,230 L590Q probably damaging Het
Fhl5 A T 4: 25,214,790 probably benign Het
Flg2 A G 3: 93,203,215 Y850C unknown Het
Gal3st2b G T 1: 93,940,790 V246L probably benign Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Jam3 A T 9: 27,106,405 I29K possibly damaging Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Lims2 A G 18: 31,957,943 S327G probably benign Het
Lynx1 A G 15: 74,751,356 Y76H probably damaging Het
Mycbp2 G A 14: 103,204,500 P1943L probably damaging Het
Myo3a A G 2: 22,565,041 D86G probably damaging Het
Nkx3-2 T A 5: 41,761,880 Q255L probably damaging Het
Notch3 C T 17: 32,153,557 R641H possibly damaging Het
Nr2c2 T A 6: 92,160,401 M431K probably damaging Het
Ogfod3 T C 11: 121,183,429 T265A probably damaging Het
Pcdh9 G T 14: 93,886,810 Y641* probably null Het
Pcdha9 T A 18: 36,999,412 D511E probably damaging Het
Pcdhgb8 A G 18: 37,762,390 Y171C probably damaging Het
Pcnx T C 12: 81,958,731 C1075R probably damaging Het
Pik3c3 C A 18: 30,311,329 probably benign Het
Pkhd1 T C 1: 20,550,873 T854A probably benign Het
Pycr1 T C 11: 120,642,135 T100A probably benign Het
Rhof T C 5: 123,104,530 probably null Het
Scn9a T A 2: 66,526,873 D1028V possibly damaging Het
Serpina3f T C 12: 104,219,481 I315T possibly damaging Het
Slc1a6 T A 10: 78,812,881 S479T possibly damaging Het
Trav3-3 A G 14: 53,666,371 K49E probably benign Het
Usp28 T C 9: 49,030,923 probably null Het
Utrn C T 10: 12,698,042 V1095I probably benign Het
Zfp217 T C 2: 170,112,518 D1038G probably damaging Het
Zfp709 A G 8: 71,890,553 R609G probably damaging Het
Zfp729a T A 13: 67,620,191 K640* probably null Het
Zfp986 A T 4: 145,892,520 probably benign Het
Zkscan6 A T 11: 65,828,225 H357L probably benign Het
Other mutations in Tmcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Tmcc1 APN 6 116043027 missense probably damaging 0.99
IGL01580:Tmcc1 APN 6 116042985 missense possibly damaging 0.91
IGL02858:Tmcc1 APN 6 116133888 missense probably damaging 0.99
IGL03226:Tmcc1 APN 6 116133976 missense probably damaging 0.99
FR4976:Tmcc1 UTSW 6 116193380 start gained probably benign
IGL02988:Tmcc1 UTSW 6 116042928 missense probably damaging 1.00
R0522:Tmcc1 UTSW 6 116042870 frame shift probably null
R0654:Tmcc1 UTSW 6 116042990 missense probably benign 0.03
R0721:Tmcc1 UTSW 6 116042870 frame shift probably null
R1392:Tmcc1 UTSW 6 116022110 missense possibly damaging 0.84
R1573:Tmcc1 UTSW 6 116133963 missense probably damaging 0.99
R1644:Tmcc1 UTSW 6 116133865 missense probably damaging 1.00
R2062:Tmcc1 UTSW 6 116043058 missense probably benign 0.01
R2065:Tmcc1 UTSW 6 116042870 frame shift probably null
R2214:Tmcc1 UTSW 6 116042870 frame shift probably null
R2240:Tmcc1 UTSW 6 116042870 frame shift probably null
R2399:Tmcc1 UTSW 6 116042870 frame shift probably null
R3683:Tmcc1 UTSW 6 116042870 frame shift probably null
R3722:Tmcc1 UTSW 6 116133822 missense possibly damaging 0.83
R4082:Tmcc1 UTSW 6 116043480 missense probably damaging 1.00
R4155:Tmcc1 UTSW 6 116133804 missense probably benign 0.18
R4619:Tmcc1 UTSW 6 116043286 missense probably damaging 1.00
R5246:Tmcc1 UTSW 6 116043420 missense probably damaging 1.00
R5568:Tmcc1 UTSW 6 116022110 missense possibly damaging 0.84
R6364:Tmcc1 UTSW 6 116043761 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTAACTGCTTTGCTGACTGACG -3'
(R):5'- AGGAAGATTGTTCTAGTGCCACTTC -3'

Sequencing Primer
(F):5'- CTGACTGACGAAAAACTCTTGTGGC -3'
(R):5'- CACTTCAGGCTCAGTAGGAG -3'
Posted On2015-04-17