Incidental Mutation 'R3926:Notch3'
ID308305
Institutional Source Beutler Lab
Gene Symbol Notch3
Ensembl Gene ENSMUSG00000038146
Gene Namenotch 3
SynonymsN3, hpbk
MMRRC Submission 040821-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3926 (G1)
Quality Score201
Status Validated
Chromosome17
Chromosomal Location32120820-32166880 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32153557 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 641 (R641H)
Ref Sequence ENSEMBL: ENSMUSP00000085016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087723]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087723
AA Change: R641H

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000085016
Gene: ENSMUSG00000038146
AA Change: R641H

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
EGF 42 78 3.73e-5 SMART
EGF 82 119 1.78e-2 SMART
EGF 123 157 1.13e-4 SMART
EGF_CA 159 196 1.89e-15 SMART
EGF 201 235 3.85e-7 SMART
EGF_CA 237 273 3.97e-9 SMART
EGF_CA 275 313 4.63e-10 SMART
EGF_CA 315 351 1.05e-8 SMART
EGF 355 390 1.28e-3 SMART
EGF_CA 392 430 6.29e-12 SMART
EGF_CA 432 468 1.11e-12 SMART
EGF_CA 470 506 4.21e-13 SMART
EGF_CA 508 544 8.43e-13 SMART
EGF_CA 546 581 9.54e-12 SMART
EGF_CA 583 619 1.31e-9 SMART
EGF_CA 621 656 2.03e-6 SMART
EGF_CA 658 694 2.28e-9 SMART
EGF 699 731 7.18e-7 SMART
EGF 738 771 2.5e-6 SMART
EGF 775 809 8e-5 SMART
EGF_CA 811 848 4.77e-12 SMART
EGF_CA 850 886 3.81e-11 SMART
EGF_CA 888 923 1.47e-12 SMART
EGF_CA 925 961 3.4e-8 SMART
EGF 966 999 5.74e-6 SMART
EGF 1004 1035 7.18e-7 SMART
EGF 1040 1083 1.21e-4 SMART
EGF_CA 1085 1121 1.29e-8 SMART
EGF_CA 1123 1159 1.45e-11 SMART
EGF_CA 1161 1204 1.26e-11 SMART
EGF 1209 1245 1.53e-1 SMART
EGF 1250 1288 8e-5 SMART
EGF 1293 1326 1.13e1 SMART
EGF 1339 1374 5.36e-6 SMART
NL 1381 1419 1.63e-15 SMART
NL 1422 1460 1.78e-16 SMART
NL 1461 1502 1.75e-15 SMART
NOD 1506 1562 2.98e-24 SMART
NODP 1577 1641 1.34e-26 SMART
transmembrane domain 1644 1666 N/A INTRINSIC
low complexity region 1774 1783 N/A INTRINSIC
ANK 1789 1834 1.48e3 SMART
ANK 1839 1868 1.61e-4 SMART
ANK 1872 1902 1.42e0 SMART
ANK 1906 1935 1.77e-1 SMART
ANK 1939 1968 3.18e-3 SMART
ANK 1972 2001 5.16e-3 SMART
low complexity region 2028 2054 N/A INTRINSIC
low complexity region 2108 2123 N/A INTRINSIC
low complexity region 2169 2193 N/A INTRINSIC
DUF3454 2218 2275 2.81e-20 SMART
Meta Mutation Damage Score 0.232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the third discovered human homologue of the Drosophilia melanogaster type I membrane protein notch. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signalling pathway that plays a key role in neural development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remains to be determined. Mutations in NOTCH3 have been identified as the underlying cause of cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). [provided by RefSeq, Jul 2008]
PHENOTYPE: Some, but not all, null alleles cause defects in artery morphology and in T cell development. Progressive emaciation and kyphosis with paraphimosis occurs in an intron 31 splice donor site point mutant. In conjunction with Notch1 deficiency, abnormalities in embryonic development have been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Arfgap2 C T 2: 91,274,805 R405W probably damaging Het
Asb14 T C 14: 26,897,738 I48T possibly damaging Het
Astn1 A T 1: 158,579,657 I559F possibly damaging Het
Atg7 C T 6: 114,673,678 T83M possibly damaging Het
Bco1 T C 8: 117,127,472 S379P probably benign Het
Bst1 T C 5: 43,840,454 V265A possibly damaging Het
Car11 T C 7: 45,700,491 F45L probably benign Het
Cdkl2 T C 5: 92,033,139 I214V possibly damaging Het
Cluap1 T A 16: 3,911,534 S141T probably damaging Het
Col11a1 C T 3: 114,090,124 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Corin T G 5: 72,372,130 D294A probably damaging Het
Crct1 C A 3: 93,014,707 probably benign Het
Ddx41 A G 13: 55,531,270 L559P probably damaging Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dennd1b A G 1: 139,143,959 N397D probably benign Het
Evc2 T A 5: 37,383,230 L590Q probably damaging Het
Fhl5 A T 4: 25,214,790 probably benign Het
Flg2 A G 3: 93,203,215 Y850C unknown Het
Gal3st2b G T 1: 93,940,790 V246L probably benign Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Jam3 A T 9: 27,106,405 I29K possibly damaging Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Lims2 A G 18: 31,957,943 S327G probably benign Het
Lynx1 A G 15: 74,751,356 Y76H probably damaging Het
Mycbp2 G A 14: 103,204,500 P1943L probably damaging Het
Myo3a A G 2: 22,565,041 D86G probably damaging Het
Nkx3-2 T A 5: 41,761,880 Q255L probably damaging Het
Nr2c2 T A 6: 92,160,401 M431K probably damaging Het
Ogfod3 T C 11: 121,183,429 T265A probably damaging Het
Pcdh9 G T 14: 93,886,810 Y641* probably null Het
Pcdha9 T A 18: 36,999,412 D511E probably damaging Het
Pcdhgb8 A G 18: 37,762,390 Y171C probably damaging Het
Pcnx T C 12: 81,958,731 C1075R probably damaging Het
Pik3c3 C A 18: 30,311,329 probably benign Het
Pkhd1 T C 1: 20,550,873 T854A probably benign Het
Pycr1 T C 11: 120,642,135 T100A probably benign Het
Rhof T C 5: 123,104,530 probably null Het
Scn9a T A 2: 66,526,873 D1028V possibly damaging Het
Serpina3f T C 12: 104,219,481 I315T possibly damaging Het
Slc1a6 T A 10: 78,812,881 S479T possibly damaging Het
Tmcc1 T C 6: 116,042,913 D166G probably damaging Het
Trav3-3 A G 14: 53,666,371 K49E probably benign Het
Usp28 T C 9: 49,030,923 probably null Het
Utrn C T 10: 12,698,042 V1095I probably benign Het
Zfp217 T C 2: 170,112,518 D1038G probably damaging Het
Zfp709 A G 8: 71,890,553 R609G probably damaging Het
Zfp729a T A 13: 67,620,191 K640* probably null Het
Zfp986 A T 4: 145,892,520 probably benign Het
Zkscan6 A T 11: 65,828,225 H357L probably benign Het
Other mutations in Notch3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Notch3 APN 17 32158114 nonsense probably null
IGL01065:Notch3 APN 17 32146416 nonsense probably null
IGL01296:Notch3 APN 17 32166757 missense unknown
IGL01322:Notch3 APN 17 32144471 missense probably damaging 1.00
IGL01343:Notch3 APN 17 32143436 missense probably benign 0.10
IGL01358:Notch3 APN 17 32144747 missense probably damaging 1.00
IGL01600:Notch3 APN 17 32144498 missense probably damaging 1.00
IGL01622:Notch3 APN 17 32158870 missense possibly damaging 0.50
IGL01623:Notch3 APN 17 32158870 missense possibly damaging 0.50
IGL01971:Notch3 APN 17 32124347 missense probably damaging 1.00
IGL02000:Notch3 APN 17 32122742 missense probably damaging 0.99
IGL02072:Notch3 APN 17 32147074 nonsense probably null
IGL02145:Notch3 APN 17 32154741 missense probably benign 0.01
IGL02256:Notch3 APN 17 32132324 missense probably damaging 1.00
IGL02366:Notch3 APN 17 32144205 missense probably benign
IGL02476:Notch3 APN 17 32158638 missense possibly damaging 0.67
IGL02502:Notch3 APN 17 32158278 nonsense probably null
IGL02551:Notch3 APN 17 32154731 splice site probably benign
divide UTSW 17 32137813 splice site probably null
lopressor UTSW 17 32153884 missense probably damaging 1.00
PIT4486001:Notch3 UTSW 17 32154763 missense probably damaging 1.00
R0115:Notch3 UTSW 17 32133462 missense possibly damaging 0.82
R0201:Notch3 UTSW 17 32156148 splice site probably benign
R0630:Notch3 UTSW 17 32147472 splice site probably benign
R1167:Notch3 UTSW 17 32122745 missense possibly damaging 0.95
R1432:Notch3 UTSW 17 32164224 missense probably benign
R1567:Notch3 UTSW 17 32158580 missense possibly damaging 0.77
R1623:Notch3 UTSW 17 32139191 missense probably benign 0.00
R1663:Notch3 UTSW 17 32156119 missense probably damaging 1.00
R1668:Notch3 UTSW 17 32158589 missense probably damaging 0.99
R1789:Notch3 UTSW 17 32158725 missense probably damaging 1.00
R1813:Notch3 UTSW 17 32143428 missense probably benign 0.08
R1837:Notch3 UTSW 17 32124322 missense probably damaging 1.00
R1896:Notch3 UTSW 17 32143428 missense probably benign 0.08
R1937:Notch3 UTSW 17 32153852 missense probably benign 0.03
R1954:Notch3 UTSW 17 32166678 missense probably benign
R2014:Notch3 UTSW 17 32158000 missense probably benign 0.00
R2058:Notch3 UTSW 17 32143644 missense probably benign
R2068:Notch3 UTSW 17 32135508 missense probably benign 0.00
R2097:Notch3 UTSW 17 32122754 missense probably damaging 1.00
R2112:Notch3 UTSW 17 32144610 missense probably benign 0.19
R2156:Notch3 UTSW 17 32147844 missense probably damaging 1.00
R2211:Notch3 UTSW 17 32147978 missense probably benign 0.00
R2324:Notch3 UTSW 17 32150134 splice site probably benign
R2432:Notch3 UTSW 17 32153804 missense probably damaging 1.00
R3117:Notch3 UTSW 17 32158115 missense probably damaging 1.00
R3236:Notch3 UTSW 17 32158461 missense probably damaging 0.96
R3409:Notch3 UTSW 17 32150702 missense possibly damaging 0.67
R3434:Notch3 UTSW 17 32158618 missense possibly damaging 0.80
R3435:Notch3 UTSW 17 32158618 missense possibly damaging 0.80
R3438:Notch3 UTSW 17 32153590 missense probably damaging 1.00
R4087:Notch3 UTSW 17 32158113 missense possibly damaging 0.60
R4115:Notch3 UTSW 17 32158433 missense probably damaging 1.00
R4214:Notch3 UTSW 17 32132207 missense possibly damaging 0.96
R4234:Notch3 UTSW 17 32141341 missense probably damaging 0.97
R4242:Notch3 UTSW 17 32143745 missense possibly damaging 0.74
R4658:Notch3 UTSW 17 32154763 missense probably damaging 1.00
R4878:Notch3 UTSW 17 32147085 missense probably damaging 1.00
R4879:Notch3 UTSW 17 32147963 missense probably benign 0.00
R4885:Notch3 UTSW 17 32141377 missense probably damaging 0.98
R4924:Notch3 UTSW 17 32144731 missense probably damaging 1.00
R5084:Notch3 UTSW 17 32157890 critical splice donor site probably null
R5086:Notch3 UTSW 17 32143334 missense probably benign 0.13
R5343:Notch3 UTSW 17 32143283 missense probably benign 0.03
R5389:Notch3 UTSW 17 32139189 missense probably benign
R5503:Notch3 UTSW 17 32147055 missense probably benign 0.00
R5698:Notch3 UTSW 17 32157987 missense probably damaging 1.00
R5824:Notch3 UTSW 17 32153861 missense possibly damaging 0.92
R5969:Notch3 UTSW 17 32153884 missense probably damaging 1.00
R6050:Notch3 UTSW 17 32143527 missense probably benign
R6274:Notch3 UTSW 17 32147290 missense probably benign
R6276:Notch3 UTSW 17 32154749 missense probably benign 0.10
R6313:Notch3 UTSW 17 32151154 intron probably null
R6316:Notch3 UTSW 17 32137813 splice site probably null
R6380:Notch3 UTSW 17 32144559 missense probably damaging 1.00
R6401:Notch3 UTSW 17 32158623 missense probably benign 0.01
R6502:Notch3 UTSW 17 32158217 missense probably damaging 1.00
R6741:Notch3 UTSW 17 32143484 missense probably benign 0.16
R7131:Notch3 UTSW 17 32144217 missense probably benign
R7140:Notch3 UTSW 17 32156377 missense possibly damaging 0.84
R7162:Notch3 UTSW 17 32146449 missense probably damaging 0.98
R7171:Notch3 UTSW 17 32158962 missense probably damaging 1.00
R7449:Notch3 UTSW 17 32157966 missense probably damaging 1.00
R7450:Notch3 UTSW 17 32141391 missense possibly damaging 0.69
R7554:Notch3 UTSW 17 32122371 missense probably benign 0.03
T0975:Notch3 UTSW 17 32146417 missense probably damaging 0.99
Z1088:Notch3 UTSW 17 32158652 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCCCTGAGACCTTTACGGAGAG -3'
(R):5'- TGGGCTATAACAGTACGTGGGG -3'

Sequencing Primer
(F):5'- GACCTTTACGGAGAGAACTGACTC -3'
(R):5'- CTATAACAGTACGTGGGGGTGTG -3'
Posted On2015-04-17