Incidental Mutation 'R3927:Tmem217'
ID308345
Institutional Source Beutler Lab
Gene Symbol Tmem217
Ensembl Gene ENSMUSG00000079580
Gene Nametransmembrane protein 217
Synonyms4933413N12Rik, EG622644
MMRRC Submission 040822-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R3927 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location29526033-29549593 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29526703 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 18 (S18P)
Ref Sequence ENSEMBL: ENSMUSP00000132463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114683] [ENSMUST00000168339]
Predicted Effect probably damaging
Transcript: ENSMUST00000114683
AA Change: S18P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110331
Gene: ENSMUSG00000079580
AA Change: S18P

DomainStartEndE-ValueType
Pfam:DUF4534 11 168 6.8e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168339
AA Change: S18P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132463
Gene: ENSMUSG00000079580
AA Change: S18P

DomainStartEndE-ValueType
Pfam:DUF4534 11 168 5.3e-62 PFAM
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A G 2: 103,708,218 probably null Het
Alpk1 T C 3: 127,677,716 H1039R probably damaging Het
Avpr1a A G 10: 122,449,711 S303G probably benign Het
Axdnd1 A G 1: 156,419,270 L79S probably damaging Het
Baz1a A G 12: 54,921,143 I667T possibly damaging Het
Bend5 A G 4: 111,448,605 Y282C possibly damaging Het
Clstn3 T C 6: 124,451,368 D438G probably damaging Het
Cog3 A G 14: 75,743,558 probably benign Het
Cyp2j6 T C 4: 96,553,288 N55S probably benign Het
Eif4b G A 15: 102,084,310 G101R probably damaging Het
Epha2 T C 4: 141,306,550 L40P probably damaging Het
Fig4 A G 10: 41,263,139 V356A probably benign Het
Hal T C 10: 93,514,026 probably benign Het
Helz A G 11: 107,685,292 Y1770C unknown Het
Meis3 A G 7: 16,177,494 T39A probably benign Het
Nod1 G T 6: 54,944,917 R139S probably benign Het
Olfr430 A T 1: 174,069,312 N5Y probably damaging Het
Pacsin3 C T 2: 91,262,941 probably null Het
Plekhh1 T A 12: 79,053,648 I130N probably damaging Het
Plxna2 G A 1: 194,746,157 E512K probably benign Het
Ppp1r9a A G 6: 5,057,531 I215M probably damaging Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Sap130 A T 18: 31,674,382 H414L possibly damaging Het
Slc33a1 A G 3: 63,963,724 I156T probably benign Het
Slc37a2 G A 9: 37,235,507 T338M probably damaging Het
Spinkl T A 18: 44,169,163 probably null Het
Tmc5 T A 7: 118,652,655 L657* probably null Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Tubb4a A G 17: 57,080,967 V353A probably benign Het
Ube3b T C 5: 114,415,680 F974L probably benign Het
Ubqln5 A G 7: 104,128,471 L382P probably damaging Het
Ufsp2 T A 8: 45,983,686 probably null Het
Unkl C T 17: 25,229,329 T66I probably damaging Het
Xrn2 T A 2: 147,038,189 N477K probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zzef1 T C 11: 72,858,382 S899P probably damaging Het
Zzz3 T C 3: 152,455,862 Y298H probably damaging Het
Other mutations in Tmem217
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01094:Tmem217 APN 17 29526592 missense probably benign 0.13
IGL01695:Tmem217 APN 17 29526348 missense probably damaging 1.00
IGL02081:Tmem217 APN 17 29526373 missense probably damaging 1.00
IGL02704:Tmem217 APN 17 29526558 missense probably damaging 1.00
IGL02804:Tmem217 APN 17 29526481 missense probably damaging 1.00
R0200:Tmem217 UTSW 17 29526310 missense probably benign 0.08
R0266:Tmem217 UTSW 17 29526599 missense possibly damaging 0.87
R0906:Tmem217 UTSW 17 29526516 missense probably damaging 1.00
R3111:Tmem217 UTSW 17 29526558 missense probably damaging 1.00
R5628:Tmem217 UTSW 17 29526456 missense probably damaging 0.98
R5822:Tmem217 UTSW 17 29526555 missense probably damaging 1.00
R6766:Tmem217 UTSW 17 29526510 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGGGCATACACAGAGTACAG -3'
(R):5'- GGTCAGCTAAAGATGCTATTATCCC -3'

Sequencing Primer
(F):5'- CAGCTGGCTATCATGGTGATG -3'
(R):5'- GCTAAAGATGCTATTATCCCCTTTAC -3'
Posted On2015-04-17