Incidental Mutation 'R3928:Abr'
ID308381
Institutional Source Beutler Lab
Gene Symbol Abr
Ensembl Gene ENSMUSG00000017631
Gene Nameactive BCR-related gene
Synonyms6330400K15Rik
MMRRC Submission 040823-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.437) question?
Stock #R3928 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location76416734-76622314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76468735 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 181 (H181Q)
Ref Sequence ENSEMBL: ENSMUSP00000104044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065028] [ENSMUST00000072740] [ENSMUST00000094012] [ENSMUST00000108407] [ENSMUST00000108408] [ENSMUST00000151526]
Predicted Effect probably benign
Transcript: ENSMUST00000065028
SMART Domains Protein: ENSMUSP00000068982
Gene: ENSMUSG00000017631

DomainStartEndE-ValueType
Pfam:RhoGEF 12 65 5.4e-11 PFAM
PH 84 243 1.58e-11 SMART
C2 287 394 1.88e-11 SMART
RhoGAP 440 619 6.57e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072740
AA Change: H227Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000072522
Gene: ENSMUSG00000017631
AA Change: H227Q

DomainStartEndE-ValueType
RhoGEF 95 283 2.37e-56 SMART
PH 302 461 1.58e-11 SMART
C2 505 612 1.88e-11 SMART
RhoGAP 658 837 6.57e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094012
AA Change: H239Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000091551
Gene: ENSMUSG00000017631
AA Change: H239Q

DomainStartEndE-ValueType
RhoGEF 107 295 2.37e-56 SMART
PH 314 473 1.58e-11 SMART
C2 517 624 1.88e-11 SMART
RhoGAP 670 849 6.57e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108407
AA Change: H181Q

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000104044
Gene: ENSMUSG00000017631
AA Change: H181Q

DomainStartEndE-ValueType
RhoGEF 49 237 2.37e-56 SMART
PH 256 415 1.58e-11 SMART
C2 459 566 1.88e-11 SMART
RhoGAP 612 791 6.57e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108408
AA Change: H190Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000104045
Gene: ENSMUSG00000017631
AA Change: H190Q

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
RhoGEF 58 246 2.37e-56 SMART
PH 265 424 1.58e-11 SMART
C2 468 575 1.88e-11 SMART
RhoGAP 621 800 6.57e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141442
Predicted Effect probably benign
Transcript: ENSMUST00000151526
AA Change: H137Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135544
Gene: ENSMUSG00000017631
AA Change: H137Q

DomainStartEndE-ValueType
RhoGEF 5 161 3.85e-24 SMART
Meta Mutation Damage Score 0.1332 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to the protein encoded by the breakpoint cluster region gene located on chromosome 22. The protein encoded by this gene contains a GTPase-activating protein domain, a domain found in members of the Rho family of GTP-binding proteins. Functional studies in mice determined that this protein plays a role in vestibular morphogenesis. Alternatively spliced transcript variants have been reported for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mutants are apparently normal, but double knockouts with Bcr show increased postnatal mortality, ataxia, hyperactivity, circling, lack of vestibular otoconia, ectopic cerebellar granule cells, and foliation defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atrx T C X: 105,879,917 I157V possibly damaging Het
Birc6 A G 17: 74,611,175 D1856G possibly damaging Het
Birc6 A G 17: 74,638,409 T2811A probably damaging Het
Brsk2 T C 7: 141,998,418 F108S probably damaging Het
Clasp2 C A 9: 113,906,105 H1004N probably benign Het
Cntd1 G A 11: 101,287,519 V315I probably benign Het
Col13a1 A G 10: 61,867,525 probably benign Het
Ctps T A 4: 120,541,896 H553L probably benign Het
Dpysl2 A G 14: 66,824,431 I242T possibly damaging Het
Exoc3l C T 8: 105,290,917 probably benign Het
Fam229a A G 4: 129,491,411 probably benign Het
Fshr C T 17: 88,985,534 R572H probably damaging Het
Gm5501 A G 18: 9,917,267 noncoding transcript Het
Gmpr A G 13: 45,529,747 I165V probably benign Het
Gnat3 G A 5: 18,003,894 probably benign Het
H1foo A G 6: 115,948,796 K185E probably benign Het
H2-Q4 T G 17: 35,379,690 L16R unknown Het
Hs2st1 T C 3: 144,434,628 K311E possibly damaging Het
Kcnj15 A G 16: 95,296,509 E330G possibly damaging Het
Kif3a A G 11: 53,570,614 K29E probably benign Het
Krtap4-1 A G 11: 99,628,157 V9A unknown Het
Lmntd2 C T 7: 141,211,204 G432S probably damaging Het
Me3 T C 7: 89,833,690 probably benign Het
Myo1d G T 11: 80,484,261 R996S probably benign Het
Myo9a T A 9: 59,895,283 W2018R probably damaging Het
Nphp3 G T 9: 104,011,730 V265F probably damaging Het
Olfr1331 T C 4: 118,868,982 L66P probably damaging Het
Olfr492 A G 7: 108,323,025 I217T probably benign Het
Olfr894 T C 9: 38,218,835 M1T probably null Het
Pgp A G 17: 24,471,341 E247G probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plch1 G A 3: 63,767,623 A202V probably damaging Het
Rbm11 G A 16: 75,593,044 probably null Het
Scg5 T C 2: 113,791,885 K124R probably damaging Het
Serpina3j A T 12: 104,319,657 H357L probably damaging Het
St6gal2 A G 17: 55,496,323 D353G possibly damaging Het
Tdpoz3 T C 3: 93,826,909 I297T possibly damaging Het
Tdrd5 G A 1: 156,300,778 T136I probably benign Het
Tfcp2l1 T A 1: 118,669,476 I429K possibly damaging Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Top1 T C 2: 160,687,749 probably benign Het
Trim61 A G 8: 65,013,317 F431L probably benign Het
Trmo C T 4: 46,382,647 G150S probably damaging Het
Vmn1r183 T C 7: 24,055,572 S267P probably damaging Het
Xirp2 T A 2: 67,511,669 F1418Y possibly damaging Het
Zfp114 T C 7: 24,181,042 V271A possibly damaging Het
Zfp710 A G 7: 80,081,386 R104G probably damaging Het
Other mutations in Abr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Abr APN 11 76423089 missense probably damaging 0.96
IGL00571:Abr APN 11 76468740 missense probably benign 0.45
IGL01774:Abr APN 11 76464299 splice site probably benign
IGL02208:Abr APN 11 76455645 missense probably damaging 1.00
IGL02477:Abr APN 11 76461360 missense probably damaging 1.00
IGL02499:Abr APN 11 76509090 missense probably benign 0.39
IGL02606:Abr APN 11 76479164 missense probably damaging 1.00
IGL02955:Abr APN 11 76419165 missense probably damaging 1.00
IGL03136:Abr APN 11 76425295 nonsense probably null
R0051:Abr UTSW 11 76472502 missense probably benign 0.02
R0311:Abr UTSW 11 76509127 missense possibly damaging 0.83
R0344:Abr UTSW 11 76479044 missense probably damaging 0.99
R0621:Abr UTSW 11 76509072 missense probably damaging 1.00
R0771:Abr UTSW 11 76455683 missense probably damaging 1.00
R1081:Abr UTSW 11 76455615 missense probably damaging 1.00
R1842:Abr UTSW 11 76508986 missense probably damaging 1.00
R2036:Abr UTSW 11 76452350 missense probably benign 0.08
R2147:Abr UTSW 11 76455648 missense probably damaging 1.00
R2250:Abr UTSW 11 76451939 missense probably damaging 1.00
R3153:Abr UTSW 11 76486469 missense probably damaging 1.00
R4507:Abr UTSW 11 76451857 missense possibly damaging 0.65
R4518:Abr UTSW 11 76472518 missense possibly damaging 0.72
R4632:Abr UTSW 11 76509019 missense probably benign 0.10
R4751:Abr UTSW 11 76456608 missense possibly damaging 0.79
R4853:Abr UTSW 11 76464261 missense probably damaging 1.00
R5255:Abr UTSW 11 76455683 missense probably damaging 1.00
R5693:Abr UTSW 11 76463577 missense probably damaging 1.00
R6459:Abr UTSW 11 76424989 missense probably damaging 0.98
R6478:Abr UTSW 11 76452332 missense probably damaging 0.99
R7030:Abr UTSW 11 76459212 missense probably damaging 1.00
R7221:Abr UTSW 11 76423161 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AAAGCTTGCTGGCATCCTAAGG -3'
(R):5'- CAATCAGTCCTGACTCTGGTTC -3'

Sequencing Primer
(F):5'- AGCACGTTTGTAGCTGGCC -3'
(R):5'- CTGGTTCTCAGAGTCTGCC -3'
Posted On2015-04-17