Incidental Mutation 'R3930:Trim43a'
ID308425
Institutional Source Beutler Lab
Gene Symbol Trim43a
Ensembl Gene ENSMUSG00000090693
Gene Nametripartite motif-containing 43A
SynonymsGm6021
MMRRC Submission 040917-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R3930 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location88580891-88588819 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88583078 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 153 (I153F)
Ref Sequence ENSEMBL: ENSMUSP00000127527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164661] [ENSMUST00000215498] [ENSMUST00000216686]
Predicted Effect probably benign
Transcript: ENSMUST00000164661
AA Change: I153F

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000127527
Gene: ENSMUSG00000090693
AA Change: I153F

DomainStartEndE-ValueType
RING 16 56 9.6e-7 SMART
Blast:BBOX 88 129 1e-7 BLAST
PDB:2VOK|B 328 445 5e-14 PDB
Blast:SPRY 335 441 1e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000215498
Predicted Effect probably benign
Transcript: ENSMUST00000216686
Meta Mutation Damage Score 0.1156 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik G T 10: 116,112,635 Q329K possibly damaging Het
Bpifb1 A G 2: 154,215,322 N400S possibly damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Crhr1 T A 11: 104,153,551 S22T probably benign Het
Cyp4a10 G T 4: 115,524,783 V221L probably benign Het
D1Pas1 G T 1: 186,968,280 W135C probably damaging Het
Dcbld2 T C 16: 58,465,338 L620P probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnm3 T C 1: 162,084,130 D66G probably damaging Het
Fzd10 G A 5: 128,602,412 V399M probably damaging Het
Gm10801 T A 2: 98,664,016 I146N possibly damaging Het
Gm20767 G A 13: 120,154,832 C69Y probably damaging Het
Gm436 C T 4: 144,670,128 E345K probably damaging Het
Gm525 T A 11: 89,075,004 probably null Het
Gpr37l1 T C 1: 135,161,362 I322V probably benign Het
Grid2ip T G 5: 143,386,039 S679R probably damaging Het
Gyg A T 3: 20,155,025 S15T probably benign Het
Hace1 G A 10: 45,711,508 C901Y probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hp1bp3 C T 4: 138,221,707 A27V probably benign Het
Hsf5 A G 11: 87,631,682 Y367C probably damaging Het
Igf2r T C 17: 12,705,829 I1034V probably benign Het
Itpr1 A G 6: 108,394,841 T1159A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrrc14 T C 15: 76,713,565 V165A probably benign Het
Lrrc45 C T 11: 120,718,677 A422V probably benign Het
Lrrk2 T A 15: 91,767,461 probably null Het
Map3k4 T C 17: 12,235,993 H1370R possibly damaging Het
Mpo A G 11: 87,801,040 Y433C probably damaging Het
Nfkbil1 G T 17: 35,220,956 Q194K probably benign Het
Nin C T 12: 70,078,242 G102E probably damaging Het
Nmt1 T C 11: 103,052,233 V138A probably benign Het
Olfr1215 A G 2: 89,002,033 F85S probably benign Het
Olfr430 T A 1: 174,069,581 F94L probably damaging Het
Olfr432 A T 1: 174,050,510 I46F probably damaging Het
Olfr629 A C 7: 103,740,587 Y218D probably damaging Het
Optc T A 1: 133,901,182 R176* probably null Het
Oxct1 T A 15: 4,037,119 N72K possibly damaging Het
Plxna2 G A 1: 194,794,910 A1243T probably benign Het
Rin1 G T 19: 5,052,974 L430F probably benign Het
Ros1 A T 10: 52,194,848 S37T possibly damaging Het
Rrp36 G T 17: 46,672,806 Q27K probably damaging Het
Sez6 T C 11: 77,976,882 I875T probably damaging Het
Sfrp5 T G 19: 42,201,818 Y65S probably damaging Het
Slc25a54 T A 3: 109,116,504 L472I probably benign Het
Slc35d3 T C 10: 19,848,859 E417G probably damaging Het
Sumf2 A G 5: 129,849,979 D52G probably benign Het
Sympk A G 7: 19,047,522 N801S possibly damaging Het
Tmem38b T C 4: 53,854,398 F210S probably damaging Het
Tnks T A 8: 34,940,812 H254L probably damaging Het
Trappc10 A T 10: 78,210,403 V451E probably benign Het
Tulp1 T C 17: 28,353,709 N213S probably damaging Het
Ubr1 T C 2: 120,916,470 D830G probably benign Het
Uqcc3 C T 19: 8,880,705 probably null Het
Vmn2r26 T A 6: 124,025,979 M116K probably benign Het
Zscan12 A G 13: 21,368,630 Q208R probably benign Het
Other mutations in Trim43a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02400:Trim43a APN 9 88582112 missense probably benign 0.00
IGL02864:Trim43a APN 9 88588112 missense probably benign 0.20
R0114:Trim43a UTSW 9 88584160 missense probably damaging 1.00
R0436:Trim43a UTSW 9 88588187 missense probably damaging 1.00
R0514:Trim43a UTSW 9 88584336 nonsense probably null
R0682:Trim43a UTSW 9 88582146 missense probably benign 0.08
R0709:Trim43a UTSW 9 88582146 missense probably benign 0.08
R0727:Trim43a UTSW 9 88582146 missense probably benign 0.08
R1237:Trim43a UTSW 9 88582989 intron probably benign
R1239:Trim43a UTSW 9 88582989 intron probably benign
R1445:Trim43a UTSW 9 88582989 intron probably benign
R1448:Trim43a UTSW 9 88582093 missense probably damaging 1.00
R1584:Trim43a UTSW 9 88588158 missense probably damaging 1.00
R1925:Trim43a UTSW 9 88582318 missense probably benign 0.08
R1992:Trim43a UTSW 9 88584259 missense probably damaging 1.00
R2074:Trim43a UTSW 9 88586094 missense possibly damaging 0.91
R3927:Trim43a UTSW 9 88582989 intron probably benign
R4418:Trim43a UTSW 9 88582153 missense probably damaging 1.00
R5488:Trim43a UTSW 9 88582176 missense probably damaging 0.97
R5489:Trim43a UTSW 9 88582176 missense probably damaging 0.97
R6498:Trim43a UTSW 9 88582342 missense probably damaging 1.00
R6742:Trim43a UTSW 9 88588346 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGCCCAGGGTGGTTGTATTC -3'
(R):5'- TGCTGTTTCACTAACATGCCTG -3'

Sequencing Primer
(F):5'- CCCAGGGTGGTTGTATTCTGTAATTC -3'
(R):5'- TCACTAACATGCCTGCAGTG -3'
Posted On2015-04-17