Incidental Mutation 'R3930:Lrrc45'
ID308438
Institutional Source Beutler Lab
Gene Symbol Lrrc45
Ensembl Gene ENSMUSG00000025145
Gene Nameleucine rich repeat containing 45
Synonyms
MMRRC Submission 040917-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R3930 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location120713925-120721128 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120718677 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 422 (A422V)
Ref Sequence ENSEMBL: ENSMUSP00000026139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018156] [ENSMUST00000026137] [ENSMUST00000026139] [ENSMUST00000055424] [ENSMUST00000106154] [ENSMUST00000106155] [ENSMUST00000142229] [ENSMUST00000145781] [ENSMUST00000151852]
Predicted Effect probably benign
Transcript: ENSMUST00000018156
SMART Domains Protein: ENSMUSP00000018156
Gene: ENSMUSG00000018012

DomainStartEndE-ValueType
RHO 6 179 8.8e-139 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026137
SMART Domains Protein: ENSMUSP00000026137
Gene: ENSMUSG00000025144

DomainStartEndE-ValueType
Pfam:CENP-X 55 107 3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026139
AA Change: A422V

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000026139
Gene: ENSMUSG00000025145
AA Change: A422V

DomainStartEndE-ValueType
LRR 57 84 9.11e0 SMART
LRR 85 112 1.01e-1 SMART
Blast:LRR 113 142 4e-11 BLAST
LRR 143 170 4.47e-3 SMART
LRR 171 198 2.2e-2 SMART
LRR 199 226 1.66e2 SMART
coiled coil region 360 645 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055424
SMART Domains Protein: ENSMUSP00000050335
Gene: ENSMUSG00000025144

DomainStartEndE-ValueType
Pfam:CENP-X 8 78 7.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106154
SMART Domains Protein: ENSMUSP00000101760
Gene: ENSMUSG00000025144

DomainStartEndE-ValueType
Pfam:CENP-X 44 114 6.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106155
SMART Domains Protein: ENSMUSP00000101761
Gene: ENSMUSG00000025144

DomainStartEndE-ValueType
low complexity region 39 50 N/A INTRINSIC
low complexity region 86 110 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134322
Predicted Effect probably benign
Transcript: ENSMUST00000142229
SMART Domains Protein: ENSMUSP00000119523
Gene: ENSMUSG00000018012

DomainStartEndE-ValueType
RHO 6 172 3.19e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145781
SMART Domains Protein: ENSMUSP00000123038
Gene: ENSMUSG00000025145

DomainStartEndE-ValueType
LRR 57 84 9.11e0 SMART
LRR 85 112 1.01e-1 SMART
Blast:LRR 113 142 1e-10 BLAST
LRR 143 170 4.47e-3 SMART
LRR 171 198 2.2e-2 SMART
LRR 199 226 1.66e2 SMART
coiled coil region 360 399 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150225
Predicted Effect probably benign
Transcript: ENSMUST00000151852
SMART Domains Protein: ENSMUSP00000115298
Gene: ENSMUSG00000025145

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
Pfam:LRR_6 85 108 1e-2 PFAM
Blast:LRR 113 142 3e-11 BLAST
Pfam:LRR_6 143 162 7.6e-3 PFAM
Pfam:LRR_1 145 159 6.8e-2 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155187
Meta Mutation Damage Score 0.1164 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik G T 10: 116,112,635 Q329K possibly damaging Het
Bpifb1 A G 2: 154,215,322 N400S possibly damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Crhr1 T A 11: 104,153,551 S22T probably benign Het
Cyp4a10 G T 4: 115,524,783 V221L probably benign Het
D1Pas1 G T 1: 186,968,280 W135C probably damaging Het
Dcbld2 T C 16: 58,465,338 L620P probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnm3 T C 1: 162,084,130 D66G probably damaging Het
Fzd10 G A 5: 128,602,412 V399M probably damaging Het
Gm10801 T A 2: 98,664,016 I146N possibly damaging Het
Gm20767 G A 13: 120,154,832 C69Y probably damaging Het
Gm436 C T 4: 144,670,128 E345K probably damaging Het
Gm525 T A 11: 89,075,004 probably null Het
Gpr37l1 T C 1: 135,161,362 I322V probably benign Het
Grid2ip T G 5: 143,386,039 S679R probably damaging Het
Gyg A T 3: 20,155,025 S15T probably benign Het
Hace1 G A 10: 45,711,508 C901Y probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hp1bp3 C T 4: 138,221,707 A27V probably benign Het
Hsf5 A G 11: 87,631,682 Y367C probably damaging Het
Igf2r T C 17: 12,705,829 I1034V probably benign Het
Itpr1 A G 6: 108,394,841 T1159A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrrc14 T C 15: 76,713,565 V165A probably benign Het
Lrrk2 T A 15: 91,767,461 probably null Het
Map3k4 T C 17: 12,235,993 H1370R possibly damaging Het
Mpo A G 11: 87,801,040 Y433C probably damaging Het
Nfkbil1 G T 17: 35,220,956 Q194K probably benign Het
Nin C T 12: 70,078,242 G102E probably damaging Het
Nmt1 T C 11: 103,052,233 V138A probably benign Het
Olfr1215 A G 2: 89,002,033 F85S probably benign Het
Olfr430 T A 1: 174,069,581 F94L probably damaging Het
Olfr432 A T 1: 174,050,510 I46F probably damaging Het
Olfr629 A C 7: 103,740,587 Y218D probably damaging Het
Optc T A 1: 133,901,182 R176* probably null Het
Oxct1 T A 15: 4,037,119 N72K possibly damaging Het
Plxna2 G A 1: 194,794,910 A1243T probably benign Het
Rin1 G T 19: 5,052,974 L430F probably benign Het
Ros1 A T 10: 52,194,848 S37T possibly damaging Het
Rrp36 G T 17: 46,672,806 Q27K probably damaging Het
Sez6 T C 11: 77,976,882 I875T probably damaging Het
Sfrp5 T G 19: 42,201,818 Y65S probably damaging Het
Slc25a54 T A 3: 109,116,504 L472I probably benign Het
Slc35d3 T C 10: 19,848,859 E417G probably damaging Het
Sumf2 A G 5: 129,849,979 D52G probably benign Het
Sympk A G 7: 19,047,522 N801S possibly damaging Het
Tmem38b T C 4: 53,854,398 F210S probably damaging Het
Tnks T A 8: 34,940,812 H254L probably damaging Het
Trappc10 A T 10: 78,210,403 V451E probably benign Het
Trim43a A T 9: 88,583,078 I153F probably benign Het
Tulp1 T C 17: 28,353,709 N213S probably damaging Het
Ubr1 T C 2: 120,916,470 D830G probably benign Het
Uqcc3 C T 19: 8,880,705 probably null Het
Vmn2r26 T A 6: 124,025,979 M116K probably benign Het
Zscan12 A G 13: 21,368,630 Q208R probably benign Het
Other mutations in Lrrc45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Lrrc45 APN 11 120720610 splice site probably benign
IGL01120:Lrrc45 APN 11 120720010 missense probably benign
IGL01536:Lrrc45 APN 11 120715584 missense probably benign 0.01
IGL01839:Lrrc45 APN 11 120717149 unclassified probably null
IGL02190:Lrrc45 APN 11 120718508 missense probably damaging 0.99
IGL02302:Lrrc45 APN 11 120718525 missense possibly damaging 0.68
IGL02724:Lrrc45 APN 11 120718318 missense probably benign 0.25
R0396:Lrrc45 UTSW 11 120714907 splice site probably benign
R0420:Lrrc45 UTSW 11 120715219 missense probably damaging 1.00
R0540:Lrrc45 UTSW 11 120715162 nonsense probably null
R0833:Lrrc45 UTSW 11 120718193 unclassified probably null
R0942:Lrrc45 UTSW 11 120718238 unclassified probably benign
R1252:Lrrc45 UTSW 11 120715471 missense probably benign 0.13
R1426:Lrrc45 UTSW 11 120720013 missense probably benign 0.00
R1543:Lrrc45 UTSW 11 120720018 missense probably benign 0.06
R1570:Lrrc45 UTSW 11 120720109 critical splice donor site probably null
R2392:Lrrc45 UTSW 11 120719539 missense probably benign 0.00
R3000:Lrrc45 UTSW 11 120718447 missense probably benign 0.00
R4158:Lrrc45 UTSW 11 120718446 missense possibly damaging 0.52
R4161:Lrrc45 UTSW 11 120718446 missense possibly damaging 0.52
R4432:Lrrc45 UTSW 11 120715221 critical splice donor site probably null
R4647:Lrrc45 UTSW 11 120719121 missense probably benign 0.02
R6030:Lrrc45 UTSW 11 120720648 nonsense probably null
R6030:Lrrc45 UTSW 11 120720648 nonsense probably null
R6220:Lrrc45 UTSW 11 120719527 missense probably benign 0.37
X0026:Lrrc45 UTSW 11 120720232 missense probably damaging 1.00
Z1088:Lrrc45 UTSW 11 120720231 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGCTGACTAACACGTCG -3'
(R):5'- TCTGACTGGGGAGCACAAAC -3'

Sequencing Primer
(F):5'- ACGTCGGCCGAGTTGAAGATC -3'
(R):5'- GCTGCCTGAACTATGGGTAC -3'
Posted On2015-04-17