Incidental Mutation 'R3930:Tulp1'
ID308448
Institutional Source Beutler Lab
Gene Symbol Tulp1
Ensembl Gene ENSMUSG00000037446
Gene Nametubby like protein 1
SynonymsTulp1l
MMRRC Submission 040917-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock #R3930 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location28351515-28365182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28353709 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 213 (N213S)
Ref Sequence ENSEMBL: ENSMUSP00000116588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041819] [ENSMUST00000114794] [ENSMUST00000114799] [ENSMUST00000123797] [ENSMUST00000129375] [ENSMUST00000154873] [ENSMUST00000156862]
Predicted Effect probably damaging
Transcript: ENSMUST00000041819
AA Change: N491S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049070
Gene: ENSMUSG00000037446
AA Change: N491S

DomainStartEndE-ValueType
internal_repeat_1 17 65 8.47e-7 PROSPERO
low complexity region 111 142 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
internal_repeat_1 160 212 8.47e-7 PROSPERO
coiled coil region 242 266 N/A INTRINSIC
Pfam:Tub 299 537 1.8e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114794
SMART Domains Protein: ENSMUSP00000110442
Gene: ENSMUSG00000037446

DomainStartEndE-ValueType
internal_repeat_1 17 65 8.5e-7 PROSPERO
low complexity region 111 142 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
internal_repeat_1 160 212 8.5e-7 PROSPERO
coiled coil region 242 266 N/A INTRINSIC
Pfam:Tub 299 449 3.4e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114799
SMART Domains Protein: ENSMUSP00000110447
Gene: ENSMUSG00000002249

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
TEA 52 123 9.04e-52 SMART
low complexity region 150 165 N/A INTRINSIC
low complexity region 181 202 N/A INTRINSIC
low complexity region 208 222 N/A INTRINSIC
low complexity region 227 244 N/A INTRINSIC
PDB:3KYS|C 248 465 1e-120 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000123797
AA Change: N213S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116588
Gene: ENSMUSG00000037446
AA Change: N213S

DomainStartEndE-ValueType
Pfam:Tub 21 228 2.1e-88 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127212
Predicted Effect probably benign
Transcript: ENSMUST00000129375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142143
Predicted Effect unknown
Transcript: ENSMUST00000148188
AA Change: N167S
SMART Domains Protein: ENSMUSP00000116844
Gene: ENSMUSG00000037446
AA Change: N167S

DomainStartEndE-ValueType
Pfam:Tub 5 214 8.8e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154873
SMART Domains Protein: ENSMUSP00000118582
Gene: ENSMUSG00000002249

DomainStartEndE-ValueType
Pfam:TEA 1 366 3.8e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156862
SMART Domains Protein: ENSMUSP00000115443
Gene: ENSMUSG00000002249

DomainStartEndE-ValueType
Pfam:TEA 1 366 3.8e-149 PFAM
Meta Mutation Damage Score 0.29 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tubby-like gene family (TULPs). Members of this family have been identified in plants, vertebrates, and invertebrates. TULP proteins share a conserved C-terminal region of approximately 200 amino acid residues. The protein encoded by this gene is thought to play a role in the physiology of photoreceptors. Mutations in this gene are associated with recessive juvenile retinitis pigmentosa and Leber congenital amaurosis-15. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mutant mice exhibit retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik G T 10: 116,112,635 Q329K possibly damaging Het
Bpifb1 A G 2: 154,215,322 N400S possibly damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Crhr1 T A 11: 104,153,551 S22T probably benign Het
Cyp4a10 G T 4: 115,524,783 V221L probably benign Het
D1Pas1 G T 1: 186,968,280 W135C probably damaging Het
Dcbld2 T C 16: 58,465,338 L620P probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnm3 T C 1: 162,084,130 D66G probably damaging Het
Fzd10 G A 5: 128,602,412 V399M probably damaging Het
Gm10801 T A 2: 98,664,016 I146N possibly damaging Het
Gm20767 G A 13: 120,154,832 C69Y probably damaging Het
Gm436 C T 4: 144,670,128 E345K probably damaging Het
Gm525 T A 11: 89,075,004 probably null Het
Gpr37l1 T C 1: 135,161,362 I322V probably benign Het
Grid2ip T G 5: 143,386,039 S679R probably damaging Het
Gyg A T 3: 20,155,025 S15T probably benign Het
Hace1 G A 10: 45,711,508 C901Y probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hp1bp3 C T 4: 138,221,707 A27V probably benign Het
Hsf5 A G 11: 87,631,682 Y367C probably damaging Het
Igf2r T C 17: 12,705,829 I1034V probably benign Het
Itpr1 A G 6: 108,394,841 T1159A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrrc14 T C 15: 76,713,565 V165A probably benign Het
Lrrc45 C T 11: 120,718,677 A422V probably benign Het
Lrrk2 T A 15: 91,767,461 probably null Het
Map3k4 T C 17: 12,235,993 H1370R possibly damaging Het
Mpo A G 11: 87,801,040 Y433C probably damaging Het
Nfkbil1 G T 17: 35,220,956 Q194K probably benign Het
Nin C T 12: 70,078,242 G102E probably damaging Het
Nmt1 T C 11: 103,052,233 V138A probably benign Het
Olfr1215 A G 2: 89,002,033 F85S probably benign Het
Olfr430 T A 1: 174,069,581 F94L probably damaging Het
Olfr432 A T 1: 174,050,510 I46F probably damaging Het
Olfr629 A C 7: 103,740,587 Y218D probably damaging Het
Optc T A 1: 133,901,182 R176* probably null Het
Oxct1 T A 15: 4,037,119 N72K possibly damaging Het
Plxna2 G A 1: 194,794,910 A1243T probably benign Het
Rin1 G T 19: 5,052,974 L430F probably benign Het
Ros1 A T 10: 52,194,848 S37T possibly damaging Het
Rrp36 G T 17: 46,672,806 Q27K probably damaging Het
Sez6 T C 11: 77,976,882 I875T probably damaging Het
Sfrp5 T G 19: 42,201,818 Y65S probably damaging Het
Slc25a54 T A 3: 109,116,504 L472I probably benign Het
Slc35d3 T C 10: 19,848,859 E417G probably damaging Het
Sumf2 A G 5: 129,849,979 D52G probably benign Het
Sympk A G 7: 19,047,522 N801S possibly damaging Het
Tmem38b T C 4: 53,854,398 F210S probably damaging Het
Tnks T A 8: 34,940,812 H254L probably damaging Het
Trappc10 A T 10: 78,210,403 V451E probably benign Het
Trim43a A T 9: 88,583,078 I153F probably benign Het
Ubr1 T C 2: 120,916,470 D830G probably benign Het
Uqcc3 C T 19: 8,880,705 probably null Het
Vmn2r26 T A 6: 124,025,979 M116K probably benign Het
Zscan12 A G 13: 21,368,630 Q208R probably benign Het
Other mutations in Tulp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01952:Tulp1 APN 17 28356424 missense probably damaging 1.00
IGL01955:Tulp1 APN 17 28356424 missense probably damaging 1.00
IGL02388:Tulp1 APN 17 28358659 missense probably damaging 1.00
IGL02511:Tulp1 APN 17 28356168 missense probably benign 0.15
IGL02973:Tulp1 APN 17 28358542 splice site probably benign
IGL03054:Tulp1 APN 17 28359313 unclassified probably benign
IGL03248:Tulp1 APN 17 28359324 missense possibly damaging 0.87
R1017:Tulp1 UTSW 17 28364303 missense probably damaging 1.00
R1543:Tulp1 UTSW 17 28362671 unclassified probably benign
R1593:Tulp1 UTSW 17 28362701 missense probably damaging 0.97
R1826:Tulp1 UTSW 17 28356367 missense possibly damaging 0.89
R2323:Tulp1 UTSW 17 28362482 missense probably damaging 1.00
R3840:Tulp1 UTSW 17 28353715 missense probably damaging 1.00
R3841:Tulp1 UTSW 17 28353715 missense probably damaging 1.00
R4690:Tulp1 UTSW 17 28351837 unclassified probably benign
R4823:Tulp1 UTSW 17 28353572 missense probably benign 0.01
R4916:Tulp1 UTSW 17 28359135 missense probably damaging 1.00
R5024:Tulp1 UTSW 17 28351995 nonsense probably null
R5159:Tulp1 UTSW 17 28359060 critical splice donor site probably null
R5249:Tulp1 UTSW 17 28362677 unclassified probably benign
R5567:Tulp1 UTSW 17 28359198 missense possibly damaging 0.47
R6072:Tulp1 UTSW 17 28363784 missense possibly damaging 0.71
R6127:Tulp1 UTSW 17 28356150 missense probably benign
R6207:Tulp1 UTSW 17 28358677 unclassified probably benign
R6416:Tulp1 UTSW 17 28356031 makesense probably null
R6773:Tulp1 UTSW 17 28362902 missense probably damaging 1.00
R7242:Tulp1 UTSW 17 28363405 intron probably null
R7323:Tulp1 UTSW 17 28356424 missense probably damaging 1.00
R7542:Tulp1 UTSW 17 28363755 missense probably benign 0.26
X0024:Tulp1 UTSW 17 28353697 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGTTTCTAGATTCCAGCATCC -3'
(R):5'- AGTCCAGTCTGAACACCAGC -3'

Sequencing Primer
(F):5'- AGCATCCTTCCCTTCATCAAG -3'
(R):5'- ACACATCCTGGCCCCTGAG -3'
Posted On2015-04-17