Incidental Mutation 'R3933:Syngr2'
ID308566
Institutional Source Beutler Lab
Gene Symbol Syngr2
Ensembl Gene ENSMUSG00000048277
Gene Namesynaptogyrin 2
SynonymsClast2, cellugyrin
MMRRC Submission 040920-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R3933 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location117809668-117814283 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 117813417 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 206 (P206Q)
Ref Sequence ENSEMBL: ENSMUSP00000026649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026649] [ENSMUST00000026661] [ENSMUST00000120928] [ENSMUST00000132298] [ENSMUST00000143852] [ENSMUST00000177131] [ENSMUST00000177241]
Predicted Effect probably damaging
Transcript: ENSMUST00000026649
AA Change: P206Q

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026649
Gene: ENSMUSG00000048277
AA Change: P206Q

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:MARVEL 20 165 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026661
SMART Domains Protein: ENSMUSP00000026661
Gene: ENSMUSG00000025574

DomainStartEndE-ValueType
Pfam:TK 19 189 9.8e-73 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120928
AA Change: P176Q

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113941
Gene: ENSMUSG00000048277
AA Change: P176Q

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:MARVEL 21 135 1.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132298
SMART Domains Protein: ENSMUSP00000135368
Gene: ENSMUSG00000093485

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
low complexity region 90 102 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141939
Predicted Effect probably benign
Transcript: ENSMUST00000143852
SMART Domains Protein: ENSMUSP00000135529
Gene: ENSMUSG00000048277

DomainStartEndE-ValueType
Pfam:MARVEL 14 118 8e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153872
Predicted Effect probably benign
Transcript: ENSMUST00000175737
SMART Domains Protein: ENSMUSP00000134879
Gene: ENSMUSG00000048277

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
Pfam:MARVEL 18 121 1.4e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176936
Predicted Effect silent
Transcript: ENSMUST00000177131
SMART Domains Protein: ENSMUSP00000134789
Gene: ENSMUSG00000048277

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:MARVEL 20 162 3.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177241
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing four transmembrane regions and a C-terminal cytoplasmic tail that is tyrosine phosphorylated. The exact function of this protein is unclear, but studies of a similar rat protein suggest that it may play a role in regulating membrane traffic in non-neuronal cells. The gene belongs to the synaptogyrin gene family. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,354,856 F3350L probably damaging Het
Acp6 T C 3: 97,166,183 V146A probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Arhgef33 A G 17: 80,373,320 I630V probably benign Het
Astn2 G A 4: 66,403,955 R136C unknown Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
C1rl T A 6: 124,508,822 L384* probably null Het
Ccdc130 G A 8: 84,260,352 A172V probably benign Het
Ccdc6 TCCGCCGCCGCC TCCGCCGCC 10: 70,189,170 probably benign Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ercc5 T A 1: 44,167,856 M643K probably benign Het
Fut8 A C 12: 77,475,259 K557N probably damaging Het
Hsdl2 T C 4: 59,597,274 Y88H probably damaging Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Itga8 A G 2: 12,189,519 I690T probably benign Het
Lepr T C 4: 101,765,301 probably benign Het
Matn2 T C 15: 34,345,420 probably null Het
Mei1 A G 15: 82,083,152 K310E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Ogdh T C 11: 6,342,601 V438A possibly damaging Het
Olfr1109 T A 2: 87,092,762 I212F probably benign Het
Olfr1293-ps T C 2: 111,527,955 Y232H probably damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Parp2 G A 14: 50,819,387 V323M probably benign Het
Pip5k1a A G 3: 95,072,003 S161P probably benign Het
Pold3 T C 7: 100,121,401 E8G probably damaging Het
Pomt1 G A 2: 32,245,619 V332I probably benign Het
Ppp2ca T A 11: 52,119,262 N232K probably damaging Het
Prune2 A T 19: 17,123,954 D2274V probably damaging Het
Pwwp2b G A 7: 139,256,034 V464I possibly damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rubcn A G 16: 32,829,259 probably null Het
Scai A T 2: 39,075,052 D593E probably benign Het
Slc24a2 T C 4: 87,176,185 T366A probably benign Het
Sp100 A G 1: 85,681,109 I320V probably benign Het
Tatdn3 A T 1: 191,046,324 probably null Het
Thsd7a C T 6: 12,555,226 G220S probably benign Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r11 C T 5: 109,053,394 A415T probably damaging Het
Vmn2r88 A G 14: 51,413,978 M258V probably benign Het
Wiz G A 17: 32,357,898 R561C probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Other mutations in Syngr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1872:Syngr2 UTSW 11 117812538 missense probably damaging 0.97
R1888:Syngr2 UTSW 11 117813398 missense possibly damaging 0.95
R1888:Syngr2 UTSW 11 117813398 missense possibly damaging 0.95
R2035:Syngr2 UTSW 11 117813360 missense probably benign 0.03
R2176:Syngr2 UTSW 11 117812580 missense probably damaging 1.00
R4584:Syngr2 UTSW 11 117813121 missense probably damaging 1.00
R4968:Syngr2 UTSW 11 117813470 missense probably damaging 1.00
R5023:Syngr2 UTSW 11 117812510 missense probably benign 0.38
R6766:Syngr2 UTSW 11 117813435 missense probably benign
R6891:Syngr2 UTSW 11 117812673 missense probably damaging 1.00
R7340:Syngr2 UTSW 11 117812496 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTCAAGATGTCCGGGTG -3'
(R):5'- GAAAGGCGTGGACTCTTTGG -3'

Sequencing Primer
(F):5'- GGCAGCCATCACCTTCAG -3'
(R):5'- GACTCTTTGGCTGTCAACTGTAACAG -3'
Posted On2015-04-17