Incidental Mutation 'R3939:Corin'
ID308590
Institutional Source Beutler Lab
Gene Symbol Corin
Ensembl Gene ENSMUSG00000005220
Gene Namecorin
SynonymsLrp4
MMRRC Submission 040826-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R3939 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location72300025-72504473 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72339879 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 531 (D531G)
Ref Sequence ENSEMBL: ENSMUSP00000135722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005352] [ENSMUST00000167460] [ENSMUST00000175766] [ENSMUST00000176974] [ENSMUST00000177290]
Predicted Effect probably benign
Transcript: ENSMUST00000005352
AA Change: D634G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000005352
Gene: ENSMUSG00000005220
AA Change: D634G

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
FRI 205 318 6.15e-11 SMART
LDLa 336 372 1.31e-8 SMART
LDLa 373 408 1.5e-8 SMART
LDLa 409 447 5.47e-11 SMART
LDLa 448 484 1.22e-8 SMART
low complexity region 508 521 N/A INTRINSIC
FRI 522 643 2.75e-31 SMART
LDLa 647 684 2.19e-10 SMART
LDLa 685 722 1.76e-5 SMART
LDLa 723 759 4.18e-7 SMART
SR 758 853 3.99e-10 SMART
Tryp_SPc 868 1097 5.45e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167460
AA Change: D568G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000127389
Gene: ENSMUSG00000005220
AA Change: D568G

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 342 1.5e-8 SMART
LDLa 343 381 5.47e-11 SMART
LDLa 382 418 1.22e-8 SMART
low complexity region 442 455 N/A INTRINSIC
FRI 456 577 2.75e-31 SMART
LDLa 581 618 2.19e-10 SMART
LDLa 619 656 1.76e-5 SMART
LDLa 657 693 4.18e-7 SMART
SR 692 787 3.99e-10 SMART
Tryp_SPc 802 1031 5.45e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175766
AA Change: D493G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000135889
Gene: ENSMUSG00000005220
AA Change: D493G

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
FRI 137 250 6.15e-11 SMART
LDLa 268 304 1.31e-8 SMART
LDLa 305 343 2.07e-11 SMART
low complexity region 367 380 N/A INTRINSIC
FRI 381 502 2.75e-31 SMART
LDLa 506 543 2.19e-10 SMART
LDLa 544 581 1.76e-5 SMART
LDLa 582 618 4.18e-7 SMART
SR 617 712 3.99e-10 SMART
Tryp_SPc 727 956 5.45e-76 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176396
Predicted Effect possibly damaging
Transcript: ENSMUST00000176974
AA Change: D531G

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135722
Gene: ENSMUSG00000005220
AA Change: D531G

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 344 3.86e-11 SMART
LDLa 345 381 1.22e-8 SMART
low complexity region 405 418 N/A INTRINSIC
FRI 419 540 2.75e-31 SMART
LDLa 544 581 2.19e-10 SMART
LDLa 582 619 1.76e-5 SMART
LDLa 620 656 4.18e-7 SMART
SR 655 750 3.99e-10 SMART
Tryp_SPc 765 994 5.45e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177290
AA Change: D501G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000135511
Gene: ENSMUSG00000005220
AA Change: D501G

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 72 185 6.15e-11 SMART
LDLa 203 239 1.31e-8 SMART
LDLa 240 275 1.5e-8 SMART
LDLa 276 314 5.47e-11 SMART
LDLa 315 351 1.22e-8 SMART
low complexity region 375 388 N/A INTRINSIC
FRI 389 510 2.75e-31 SMART
LDLa 514 551 2.19e-10 SMART
LDLa 552 589 1.76e-5 SMART
LDLa 590 626 4.18e-7 SMART
SR 625 720 3.99e-10 SMART
Tryp_SPc 735 964 5.45e-76 SMART
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. Members of this family are composed of multiple structurally distinct domains. The encoded protein converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates blood volume and pressure. This protein may also function as a pro-brain-type natriuretic peptide convertase. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display hypertension that is enhanced by high-salt diet and pregnancy, increased body weight, and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Cacnb4 C A 2: 52,469,489 R169L probably damaging Het
Col13a1 T C 10: 61,863,082 I491V unknown Het
Cx3cr1 C T 9: 120,051,644 V231I probably benign Het
Dennd4c T G 4: 86,774,280 V9G probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Faf1 T G 4: 109,861,879 L394R probably damaging Het
Fgfr4 G A 13: 55,156,494 D116N probably null Het
Flt3 A G 5: 147,356,243 Y518H possibly damaging Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Gk2 T A 5: 97,455,352 L542F possibly damaging Het
Gm4922 T A 10: 18,784,614 E120V probably damaging Het
Hip1 A T 5: 135,428,764 I285N probably benign Het
Kcnd2 C A 6: 21,217,096 D266E probably damaging Het
Kdr C T 5: 75,972,429 W63* probably null Het
Kit A G 5: 75,609,318 D130G probably benign Het
Megf8 G A 7: 25,359,202 V2208I probably benign Het
Neto2 G A 8: 85,674,118 T16I probably damaging Het
Nktr T A 9: 121,749,069 probably benign Het
Nrxn1 A G 17: 90,208,421 I1207T probably damaging Het
Obox7 G A 7: 14,664,047 G4D probably benign Het
Ogdh G A 11: 6,350,655 W827* probably null Het
Olfr1223 T A 2: 89,144,130 K298* probably null Het
Olfr309 T C 7: 86,306,229 M295V probably benign Het
Olfr726 A G 14: 50,083,716 *322Q probably null Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sbpl T A 17: 23,953,643 I101L probably benign Het
Serpina9 T A 12: 104,008,892 M1L probably benign Het
Stxbp6 A G 12: 44,902,858 probably null Het
Synpo2 A G 3: 123,114,590 V359A probably damaging Het
Ttyh1 T A 7: 4,129,318 L155H probably damaging Het
Vil1 A G 1: 74,432,415 D785G probably benign Het
Zfp345 G A 2: 150,472,553 H355Y probably damaging Het
Other mutations in Corin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Corin APN 5 72304888 missense probably damaging 1.00
IGL01114:Corin APN 5 72305011 missense probably damaging 1.00
IGL01351:Corin APN 5 72338991 missense probably damaging 1.00
IGL01516:Corin APN 5 72454487 nonsense probably null
IGL01785:Corin APN 5 72339876 missense probably damaging 1.00
IGL01786:Corin APN 5 72339876 missense probably damaging 1.00
IGL01845:Corin APN 5 72353939 missense probably damaging 1.00
IGL02097:Corin APN 5 72372146 missense probably damaging 1.00
IGL02629:Corin APN 5 72332673 missense probably damaging 1.00
IGL03085:Corin APN 5 72353930 missense probably damaging 1.00
IGL03120:Corin APN 5 72360689 missense probably damaging 1.00
IGL03150:Corin APN 5 72302858 missense probably damaging 1.00
IGL03183:Corin APN 5 72301586 missense probably damaging 0.99
IGL03185:Corin APN 5 72332781 missense probably damaging 1.00
IGL03408:Corin APN 5 72342961 missense probably benign 0.40
alpaca UTSW 5 72503952 missense possibly damaging 0.85
R0078:Corin UTSW 5 72454473 missense possibly damaging 0.77
R0724:Corin UTSW 5 72332795 splice site probably benign
R1065:Corin UTSW 5 72301650 nonsense probably null
R1301:Corin UTSW 5 72304933 missense possibly damaging 0.81
R1466:Corin UTSW 5 72302790 critical splice donor site probably null
R1466:Corin UTSW 5 72302790 critical splice donor site probably null
R1520:Corin UTSW 5 72330895 missense probably damaging 1.00
R1584:Corin UTSW 5 72302790 critical splice donor site probably null
R1617:Corin UTSW 5 72503952 missense possibly damaging 0.85
R1912:Corin UTSW 5 72358403 missense probably damaging 1.00
R2059:Corin UTSW 5 72316051 missense possibly damaging 0.76
R2173:Corin UTSW 5 72504079 missense probably benign 0.01
R2242:Corin UTSW 5 72332711 missense probably damaging 1.00
R2373:Corin UTSW 5 72339038 missense probably damaging 1.00
R2850:Corin UTSW 5 72304955 missense probably damaging 1.00
R3683:Corin UTSW 5 72330855 missense probably damaging 1.00
R3684:Corin UTSW 5 72330855 missense probably damaging 1.00
R3790:Corin UTSW 5 72435298 missense probably benign 0.38
R3847:Corin UTSW 5 72422165 missense probably benign 0.13
R3926:Corin UTSW 5 72372130 missense probably damaging 1.00
R3945:Corin UTSW 5 72358424 missense probably damaging 1.00
R4079:Corin UTSW 5 72503883 missense probably benign 0.03
R4224:Corin UTSW 5 72343108 missense probably damaging 1.00
R4473:Corin UTSW 5 72339057 missense probably damaging 1.00
R4585:Corin UTSW 5 72329699 missense probably damaging 1.00
R4586:Corin UTSW 5 72329699 missense probably damaging 1.00
R4849:Corin UTSW 5 72302835 missense probably damaging 1.00
R4926:Corin UTSW 5 72372182 missense probably damaging 1.00
R5080:Corin UTSW 5 72353851 intron probably benign
R5138:Corin UTSW 5 72339059 missense probably damaging 1.00
R5262:Corin UTSW 5 72304955 missense probably damaging 1.00
R5268:Corin UTSW 5 72343019 missense probably damaging 1.00
R5302:Corin UTSW 5 72316098 missense probably benign 0.07
R5307:Corin UTSW 5 72356978 missense probably damaging 1.00
R5324:Corin UTSW 5 72435257 missense probably damaging 1.00
R5352:Corin UTSW 5 72305033 missense probably benign 0.04
R5373:Corin UTSW 5 72304953 missense probably damaging 1.00
R5374:Corin UTSW 5 72304953 missense probably damaging 1.00
R5484:Corin UTSW 5 72358484 missense probably benign 0.15
R5502:Corin UTSW 5 72316106 nonsense probably null
R5544:Corin UTSW 5 72305014 nonsense probably null
R5682:Corin UTSW 5 72422154 missense possibly damaging 0.85
R5818:Corin UTSW 5 72435395 missense probably benign 0.00
R5992:Corin UTSW 5 72316389 missense probably benign 0.01
R6115:Corin UTSW 5 72360729 missense probably damaging 1.00
R6181:Corin UTSW 5 72372096 critical splice donor site probably null
R6317:Corin UTSW 5 72339045 missense probably damaging 1.00
R7053:Corin UTSW 5 72301527 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- AGCATCGAACCAATACGTGC -3'
(R):5'- GCATTCTGAGCATACATTTCTCATG -3'

Sequencing Primer
(F):5'- GCACCTTCTAGAGCAATCAGGTAG -3'
(R):5'- TGGAGCTACATGACTTCTGACAC -3'
Posted On2015-04-17