Incidental Mutation 'R3939:Flt3'
ID308596
Institutional Source Beutler Lab
Gene Symbol Flt3
Ensembl Gene ENSMUSG00000042817
Gene NameFMS-like tyrosine kinase 3
SynonymsFlt-3, CD135, Flk-2, wmfl, Flk2
MMRRC Submission 040826-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3939 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location147330741-147400489 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 147356243 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 518 (Y518H)
Ref Sequence ENSEMBL: ENSMUSP00000039041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049324]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049324
AA Change: Y518H

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000039041
Gene: ENSMUSG00000042817
AA Change: Y518H

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
IG 79 162 1.87e0 SMART
IG 258 346 2.57e0 SMART
internal_repeat_1 380 529 8.53e-14 PROSPERO
TyrKc 611 946 1.7e-140 SMART
Meta Mutation Damage Score 0.014 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class III receptor tyrosine kinase that regulates hematopoiesis. This receptor is activated by binding of the fms-related tyrosine kinase 3 ligand to the extracellular domain, which induces homodimer formation in the plasma membrane leading to autophosphorylation of the receptor. The activated receptor kinase subsequently phosphorylates and activates multiple cytoplasmic effector molecules in pathways involved in apoptosis, proliferation, and differentiation of hematopoietic cells in bone marrow. Mutations that result in the constitutive activation of this receptor result in acute myeloid leukemia and acute lymphoblastic leukemia. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice functionally null for this gene display abnormal lymphopoiesis. Homozygous ENU mutant mice are sensitive to infection by mouse cytomegalovirus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Cacnb4 C A 2: 52,469,489 R169L probably damaging Het
Col13a1 T C 10: 61,863,082 I491V unknown Het
Corin T C 5: 72,339,879 D531G possibly damaging Het
Cx3cr1 C T 9: 120,051,644 V231I probably benign Het
Dennd4c T G 4: 86,774,280 V9G probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Faf1 T G 4: 109,861,879 L394R probably damaging Het
Fgfr4 G A 13: 55,156,494 D116N probably null Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Gk2 T A 5: 97,455,352 L542F possibly damaging Het
Gm4922 T A 10: 18,784,614 E120V probably damaging Het
Hip1 A T 5: 135,428,764 I285N probably benign Het
Kcnd2 C A 6: 21,217,096 D266E probably damaging Het
Kdr C T 5: 75,972,429 W63* probably null Het
Kit A G 5: 75,609,318 D130G probably benign Het
Megf8 G A 7: 25,359,202 V2208I probably benign Het
Neto2 G A 8: 85,674,118 T16I probably damaging Het
Nktr T A 9: 121,749,069 probably benign Het
Nrxn1 A G 17: 90,208,421 I1207T probably damaging Het
Obox7 G A 7: 14,664,047 G4D probably benign Het
Ogdh G A 11: 6,350,655 W827* probably null Het
Olfr1223 T A 2: 89,144,130 K298* probably null Het
Olfr309 T C 7: 86,306,229 M295V probably benign Het
Olfr726 A G 14: 50,083,716 *322Q probably null Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sbpl T A 17: 23,953,643 I101L probably benign Het
Serpina9 T A 12: 104,008,892 M1L probably benign Het
Stxbp6 A G 12: 44,902,858 probably null Het
Synpo2 A G 3: 123,114,590 V359A probably damaging Het
Ttyh1 T A 7: 4,129,318 L155H probably damaging Het
Vil1 A G 1: 74,432,415 D785G probably benign Het
Zfp345 G A 2: 150,472,553 H355Y probably damaging Het
Other mutations in Flt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Flt3 APN 5 147354876 missense probably damaging 1.00
IGL01083:Flt3 APN 5 147354870 missense probably damaging 1.00
IGL01749:Flt3 APN 5 147358028 missense probably benign 0.02
IGL01765:Flt3 APN 5 147357978 missense probably benign
IGL02109:Flt3 APN 5 147350681 missense probably benign 0.00
IGL02490:Flt3 APN 5 147331296 missense probably damaging 1.00
IGL02631:Flt3 APN 5 147344552 missense probably damaging 1.00
IGL03117:Flt3 APN 5 147356210 missense probably benign
flick UTSW 5 147341238 missense probably damaging 1.00
warmflash UTSW 5 147366918 critical splice donor site probably null
R0070:Flt3 UTSW 5 147372726 splice site probably benign
R0070:Flt3 UTSW 5 147372726 splice site probably benign
R0320:Flt3 UTSW 5 147369579 splice site probably benign
R0347:Flt3 UTSW 5 147357992 missense probably damaging 1.00
R0512:Flt3 UTSW 5 147341270 nonsense probably null
R0968:Flt3 UTSW 5 147341227 missense possibly damaging 0.46
R1180:Flt3 UTSW 5 147341238 missense probably damaging 1.00
R1266:Flt3 UTSW 5 147356860 missense probably benign 0.00
R1562:Flt3 UTSW 5 147344513 missense probably damaging 1.00
R1803:Flt3 UTSW 5 147367055 nonsense probably null
R2000:Flt3 UTSW 5 147341238 missense probably damaging 1.00
R2021:Flt3 UTSW 5 147369490 missense probably damaging 0.98
R2079:Flt3 UTSW 5 147355083 missense probably damaging 0.97
R2261:Flt3 UTSW 5 147348063 missense probably benign 0.00
R2263:Flt3 UTSW 5 147348063 missense probably benign 0.00
R3087:Flt3 UTSW 5 147348046 missense probably benign 0.15
R3727:Flt3 UTSW 5 147354923 missense probably damaging 0.96
R4469:Flt3 UTSW 5 147375644 splice site silent
R4527:Flt3 UTSW 5 147356353 missense probably benign 0.37
R4592:Flt3 UTSW 5 147354699 missense possibly damaging 0.67
R4655:Flt3 UTSW 5 147349593 missense possibly damaging 0.51
R4686:Flt3 UTSW 5 147377048 missense probably damaging 1.00
R4867:Flt3 UTSW 5 147334440 missense probably damaging 1.00
R4897:Flt3 UTSW 5 147369300 missense probably damaging 1.00
R4941:Flt3 UTSW 5 147356375 critical splice acceptor site probably null
R5254:Flt3 UTSW 5 147375690 missense possibly damaging 0.60
R5325:Flt3 UTSW 5 147375649 missense probably benign 0.00
R5395:Flt3 UTSW 5 147354823 missense probably damaging 1.00
R5445:Flt3 UTSW 5 147355095 nonsense probably null
R5469:Flt3 UTSW 5 147355083 missense possibly damaging 0.63
R5556:Flt3 UTSW 5 147332997 unclassified probably null
R5660:Flt3 UTSW 5 147369481 missense possibly damaging 0.79
R5879:Flt3 UTSW 5 147334909 missense probably damaging 1.00
R5885:Flt3 UTSW 5 147349629 missense probably damaging 1.00
R6554:Flt3 UTSW 5 147375735 missense probably damaging 0.99
R6813:Flt3 UTSW 5 147354843 missense probably damaging 0.97
X0018:Flt3 UTSW 5 147367066 missense possibly damaging 0.54
Z1088:Flt3 UTSW 5 147349564 critical splice donor site probably null
Z31818:Flt3 UTSW 5 147366918 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTCAGAACTGGGCAATCTC -3'
(R):5'- GTAGAAACCCTGCCTTCCTG -3'

Sequencing Primer
(F):5'- TCAGAACTGGGCAATCTCATAAG -3'
(R):5'- CAGAAAAGTGTTTGGCCAG -3'
Posted On2015-04-17