Mutagenetix > Incidental Mutation

Incidental Mutation 'R3939:Ttyh1'

308599

Institutional Source

Beutler Lab

Gene Symbol

Ttyh1

Ensembl Gene

ENSMUSG00000030428

Gene Name

tweety family member 1

Synonyms

tty, 4930459B04Rik, 6330408P11Rik

MMRRC Submission

040826-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3939 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4122418-4139206 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 4132317 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 155 (L155H)

Ref Sequence

ENSEMBL: ENSMUSP00000146131 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032594] [ENSMUST00000079415] [ENSMUST00000119661] [ENSMUST00000129423] [ENSMUST00000206869] [ENSMUST00000206987] [ENSMUST00000153673]

AlphaFold

Q9D3A9

Predicted Effect

probably benign
Transcript: ENSMUST00000032594

SMART Domains

Protein: ENSMUSP00000032594
Gene: ENSMUSG00000030428

Domain	Start	End	E-Value	Type
Pfam:Tweety	1	72	4.7e-17	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000079415
AA Change: L251H

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000078384
Gene: ENSMUSG00000030428
AA Change: L251H

Domain	Start	End	E-Value	Type
Pfam:Tweety	26	428	3.2e-165	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000119661
AA Change: L251H

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000113937
Gene: ENSMUSG00000030428
AA Change: L251H

Domain	Start	End	E-Value	Type
Pfam:Tweety	26	435	1.9e-167	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126971

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128317

Predicted Effect

possibly damaging
Transcript: ENSMUST00000129423
AA Change: L251H

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000120182
Gene: ENSMUSG00000030428
AA Change: L251H

Domain	Start	End	E-Value	Type
Pfam:Tweety	26	435	1.9e-167	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130150

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148951

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132400

Predicted Effect

probably damaging
Transcript: ENSMUST00000206869
AA Change: L155H

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134536

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205971

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140637

Predicted Effect

probably benign
Transcript: ENSMUST00000206987

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151959

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139789

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148760

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148318

Predicted Effect

probably benign
Transcript: ENSMUST00000153673

SMART Domains

Protein: ENSMUSP00000115623
Gene: ENSMUSG00000030428

Domain	Start	End	E-Value	Type
Pfam:Tweety	26	103	1.3e-23	PFAM

Meta Mutation Damage Score

0.4745

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

97% (37/38)

MGI Phenotype

FUNCTION: This gene encodes a member of the Tweety family of membrane proteins. Members of this family contain five predicted transmembrane regions that are arranged in a characteristic pattern. In mouse, the protein is predominantly localized to the endoplasmic reticulum and displays calcium binding activity. Targeted knock out of this gene results in early embryonic lethality prior to the blastocyst stage. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before implantation with arrest before the blastocyst stage and mitotic failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	C	T	X: 69,438,135 (GRCm39)	A53T	probably benign	Het
Atp13a2	T	C	4: 140,733,733 (GRCm39)	S1041P	probably damaging	Het
Brinp3	C	A	1: 146,627,599 (GRCm39)	D277E	probably damaging	Het
Cacnb4	C	A	2: 52,359,501 (GRCm39)	R169L	probably damaging	Het
Col13a1	T	C	10: 61,698,861 (GRCm39)	I491V	unknown	Het
Corin	T	C	5: 72,497,222 (GRCm39)	D531G	possibly damaging	Het
Cx3cr1	C	T	9: 119,880,710 (GRCm39)	V231I	probably benign	Het
Dennd4c	T	G	4: 86,692,517 (GRCm39)	V9G	probably damaging	Het
Dysf	G	A	6: 84,163,491 (GRCm39)		probably null	Het
Faf1	T	G	4: 109,719,076 (GRCm39)	L394R	probably damaging	Het
Fgfr4	G	A	13: 55,304,307 (GRCm39)	D116N	probably null	Het
Flt3	A	G	5: 147,293,053 (GRCm39)	Y518H	possibly damaging	Het
Frem3	T	C	8: 81,341,649 (GRCm39)	I1314T	possibly damaging	Het
Gk2	T	A	5: 97,603,211 (GRCm39)	L542F	possibly damaging	Het
Gm4922	T	A	10: 18,660,362 (GRCm39)	E120V	probably damaging	Het
Hip1	A	T	5: 135,457,618 (GRCm39)	I285N	probably benign	Het
Kcnd2	C	A	6: 21,217,095 (GRCm39)	D266E	probably damaging	Het
Kdr	C	T	5: 76,133,089 (GRCm39)	W63*	probably null	Het
Kit	A	G	5: 75,769,978 (GRCm39)	D130G	probably benign	Het
Megf8	G	A	7: 25,058,627 (GRCm39)	V2208I	probably benign	Het
Neto2	G	A	8: 86,400,747 (GRCm39)	T16I	probably damaging	Het
Nktr	T	A	9: 121,578,135 (GRCm39)		probably benign	Het
Nrxn1	A	G	17: 90,515,849 (GRCm39)	I1207T	probably damaging	Het
Obox7	G	A	7: 14,397,972 (GRCm39)	G4D	probably benign	Het
Ogdh	G	A	11: 6,300,655 (GRCm39)	W827*	probably null	Het
Or13g1	T	C	7: 85,955,437 (GRCm39)	M295V	probably benign	Het
Or4c118	T	A	2: 88,974,474 (GRCm39)	K298*	probably null	Het
Or4k15c	A	G	14: 50,321,173 (GRCm39)	*322Q	probably null	Het
Pcdhga9	G	A	18: 37,871,995 (GRCm39)	R608H	probably benign	Het
Rin2	C	T	2: 145,702,366 (GRCm39)	T354I	probably benign	Het
Sbpl	T	A	17: 24,172,617 (GRCm39)	I101L	probably benign	Het
Serpina9	T	A	12: 103,975,151 (GRCm39)	M1L	probably benign	Het
Stxbp6	A	G	12: 44,949,641 (GRCm39)		probably null	Het
Synpo2	A	G	3: 122,908,239 (GRCm39)	V359A	probably damaging	Het
Vil1	A	G	1: 74,471,574 (GRCm39)	D785G	probably benign	Het
Zfp345	G	A	2: 150,314,473 (GRCm39)	H355Y	probably damaging	Het

Other mutations in Ttyh1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01410:Ttyh1	APN	7	4,127,656 (GRCm39)	missense	probably damaging	1.00
IGL01730:Ttyh1	APN	7	4,128,720 (GRCm39)	missense	possibly damaging	0.90
IGL02052:Ttyh1	APN	7	4,133,573 (GRCm39)	unclassified	probably benign
IGL02410:Ttyh1	APN	7	4,136,898 (GRCm39)	utr 3 prime	probably benign
IGL02651:Ttyh1	APN	7	4,127,678 (GRCm39)	missense	probably damaging	1.00
PIT4468001:Ttyh1	UTSW	7	4,122,771 (GRCm39)	missense	possibly damaging	0.49
R0137:Ttyh1	UTSW	7	4,127,719 (GRCm39)	missense	possibly damaging	0.95
R1699:Ttyh1	UTSW	7	4,122,695 (GRCm39)	missense	possibly damaging	0.79
R1739:Ttyh1	UTSW	7	4,132,348 (GRCm39)	missense	probably benign	0.18
R1865:Ttyh1	UTSW	7	4,122,730 (GRCm39)	missense	probably damaging	1.00
R2258:Ttyh1	UTSW	7	4,131,183 (GRCm39)	missense	probably damaging	0.98
R2259:Ttyh1	UTSW	7	4,131,183 (GRCm39)	missense	probably damaging	0.98
R2260:Ttyh1	UTSW	7	4,131,183 (GRCm39)	missense	probably damaging	0.98
R3027:Ttyh1	UTSW	7	4,122,721 (GRCm39)	missense	probably benign	0.31
R3426:Ttyh1	UTSW	7	4,136,218 (GRCm39)	critical splice donor site	probably null
R3941:Ttyh1	UTSW	7	4,132,317 (GRCm39)	missense	probably damaging	0.97
R4328:Ttyh1	UTSW	7	4,133,580 (GRCm39)	missense	probably damaging	0.99
R4329:Ttyh1	UTSW	7	4,133,580 (GRCm39)	missense	probably damaging	0.99
R4527:Ttyh1	UTSW	7	4,122,763 (GRCm39)	missense	probably damaging	1.00
R4849:Ttyh1	UTSW	7	4,125,533 (GRCm39)	missense	possibly damaging	0.84
R4898:Ttyh1	UTSW	7	4,136,735 (GRCm39)	missense	probably benign	0.03
R4931:Ttyh1	UTSW	7	4,136,943 (GRCm39)	utr 3 prime	probably benign
R4960:Ttyh1	UTSW	7	4,131,225 (GRCm39)	missense	probably damaging	1.00
R6158:Ttyh1	UTSW	7	4,128,561 (GRCm39)	missense	probably benign	0.00
R6362:Ttyh1	UTSW	7	4,132,323 (GRCm39)	missense	possibly damaging	0.67
R6799:Ttyh1	UTSW	7	4,136,221 (GRCm39)	splice site	probably null
R6823:Ttyh1	UTSW	7	4,125,528 (GRCm39)	missense	probably damaging	0.97
R6897:Ttyh1	UTSW	7	4,127,649 (GRCm39)	utr 3 prime	probably benign
R7070:Ttyh1	UTSW	7	4,136,363 (GRCm39)	missense	probably damaging	0.99
R7236:Ttyh1	UTSW	7	4,136,663 (GRCm39)	missense	probably benign	0.00
R7287:Ttyh1	UTSW	7	4,128,657 (GRCm39)	missense	probably benign	0.02
R8039:Ttyh1	UTSW	7	4,125,540 (GRCm39)	missense	probably benign	0.01
R8056:Ttyh1	UTSW	7	4,127,622 (GRCm39)	intron	probably benign
R8236:Ttyh1	UTSW	7	4,128,547 (GRCm39)	missense	probably benign	0.02
R8684:Ttyh1	UTSW	7	4,133,791 (GRCm39)	splice site	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGTCAGTCATGGGCCATAC -3'
(R):5'- AGACTTCAGCTTTCCTCAGACTG -3'

Sequencing Primer
(F):5'- GGCCATACCCCGCCCTTTAC -3'
(R):5'- TGCTCTCAGGATCCAGCAATTAAGG -3'

Posted On

2015-04-17