Incidental Mutation 'R3939:Cx3cr1'
ID308606
Institutional Source Beutler Lab
Gene Symbol Cx3cr1
Ensembl Gene ENSMUSG00000052336
Gene Namechemokine (C-X3-C motif) receptor 1
Synonyms
MMRRC Submission 040826-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R3939 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119901616-120069879 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120051644 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 231 (V231I)
Ref Sequence ENSEMBL: ENSMUSP00000150463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064165] [ENSMUST00000177637] [ENSMUST00000215016]
Predicted Effect probably benign
Transcript: ENSMUST00000064165
AA Change: V231I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000063986
Gene: ENSMUSG00000052336
AA Change: V231I

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 8.3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177637
AA Change: V231I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336
AA Change: V231I

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215016
AA Change: V231I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fractalkine is a transmembrane protein and chemokine involved in the adhesion and migration of leukocytes. The protein encoded by this gene is a receptor for fractalkine. The encoded protein also is a coreceptor for HIV-1, and some variations in this gene lead to increased susceptibility to HIV-1 infection and rapid progression to AIDS. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
PHENOTYPE: Age related retinal degeneration with abnormal subretinal microglial cell accumulation in one homozygous null mice. Other null mice shows impaired monocyte recruitment after vascular injury, kidney ischemia and reperfusion, and bacterial infection of the instestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Cacnb4 C A 2: 52,469,489 R169L probably damaging Het
Col13a1 T C 10: 61,863,082 I491V unknown Het
Corin T C 5: 72,339,879 D531G possibly damaging Het
Dennd4c T G 4: 86,774,280 V9G probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Faf1 T G 4: 109,861,879 L394R probably damaging Het
Fgfr4 G A 13: 55,156,494 D116N probably null Het
Flt3 A G 5: 147,356,243 Y518H possibly damaging Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Gk2 T A 5: 97,455,352 L542F possibly damaging Het
Gm4922 T A 10: 18,784,614 E120V probably damaging Het
Hip1 A T 5: 135,428,764 I285N probably benign Het
Kcnd2 C A 6: 21,217,096 D266E probably damaging Het
Kdr C T 5: 75,972,429 W63* probably null Het
Kit A G 5: 75,609,318 D130G probably benign Het
Megf8 G A 7: 25,359,202 V2208I probably benign Het
Neto2 G A 8: 85,674,118 T16I probably damaging Het
Nktr T A 9: 121,749,069 probably benign Het
Nrxn1 A G 17: 90,208,421 I1207T probably damaging Het
Obox7 G A 7: 14,664,047 G4D probably benign Het
Ogdh G A 11: 6,350,655 W827* probably null Het
Olfr1223 T A 2: 89,144,130 K298* probably null Het
Olfr309 T C 7: 86,306,229 M295V probably benign Het
Olfr726 A G 14: 50,083,716 *322Q probably null Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sbpl T A 17: 23,953,643 I101L probably benign Het
Serpina9 T A 12: 104,008,892 M1L probably benign Het
Stxbp6 A G 12: 44,902,858 probably null Het
Synpo2 A G 3: 123,114,590 V359A probably damaging Het
Ttyh1 T A 7: 4,129,318 L155H probably damaging Het
Vil1 A G 1: 74,432,415 D785G probably benign Het
Zfp345 G A 2: 150,472,553 H355Y probably damaging Het
Other mutations in Cx3cr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03339:Cx3cr1 APN 9 120051437 nonsense probably null
R0507:Cx3cr1 UTSW 9 120051956 missense probably damaging 1.00
R1777:Cx3cr1 UTSW 9 120051593 missense probably damaging 1.00
R2099:Cx3cr1 UTSW 9 120052273 missense probably benign 0.00
R2120:Cx3cr1 UTSW 9 120051683 missense probably damaging 1.00
R3746:Cx3cr1 UTSW 9 120052066 missense probably damaging 1.00
R3747:Cx3cr1 UTSW 9 120052066 missense probably damaging 1.00
R3748:Cx3cr1 UTSW 9 120052066 missense probably damaging 1.00
R4629:Cx3cr1 UTSW 9 120051664 missense probably damaging 1.00
R6185:Cx3cr1 UTSW 9 120051378 missense probably benign 0.06
R6244:Cx3cr1 UTSW 9 120051694 missense probably damaging 1.00
R6790:Cx3cr1 UTSW 9 120051767 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGTCCCAGGTATCTTCTG -3'
(R):5'- AACGAGTGTCTGGGTGACTAC -3'

Sequencing Primer
(F):5'- TGAACTTTTCCCCGGCAAAGG -3'
(R):5'- TGACTACCCCGAGGTCCTG -3'
Posted On2015-04-17