Incidental Mutation 'R3939:Olfr726'
ID308615
Institutional Source Beutler Lab
Gene Symbol Olfr726
Ensembl Gene ENSMUSG00000060523
Gene Nameolfactory receptor 726
SynonymsMOR246-4, GA_x6K02T2PMLR-5775299-5774334
MMRRC Submission 040826-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R3939 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50083570-50090953 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 50083716 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 322 (*322Q)
Ref Sequence ENSEMBL: ENSMUSP00000149373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072370] [ENSMUST00000206834] [ENSMUST00000213345] [ENSMUST00000215105] [ENSMUST00000215278] [ENSMUST00000217025] [ENSMUST00000217319] [ENSMUST00000217422]
Predicted Effect probably null
Transcript: ENSMUST00000072370
AA Change: *322Q
SMART Domains Protein: ENSMUSP00000072207
Gene: ENSMUSG00000060523
AA Change: *322Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 1.3e-47 PFAM
Pfam:7TM_GPCR_Srsx 36 288 5.4e-8 PFAM
Pfam:7tm_1 41 287 7.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205951
AA Change: *322Q
Predicted Effect probably null
Transcript: ENSMUST00000206834
AA Change: *322Q
Predicted Effect probably null
Transcript: ENSMUST00000213345
AA Change: *322Q
Predicted Effect probably null
Transcript: ENSMUST00000215105
AA Change: *322Q
Predicted Effect probably null
Transcript: ENSMUST00000215278
AA Change: *322Q
Predicted Effect probably null
Transcript: ENSMUST00000217025
AA Change: *322Q
Predicted Effect probably null
Transcript: ENSMUST00000217319
AA Change: *322Q
Predicted Effect probably null
Transcript: ENSMUST00000217422
AA Change: *322Q
Meta Mutation Damage Score 0.6172 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Cacnb4 C A 2: 52,469,489 R169L probably damaging Het
Col13a1 T C 10: 61,863,082 I491V unknown Het
Corin T C 5: 72,339,879 D531G possibly damaging Het
Cx3cr1 C T 9: 120,051,644 V231I probably benign Het
Dennd4c T G 4: 86,774,280 V9G probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Faf1 T G 4: 109,861,879 L394R probably damaging Het
Fgfr4 G A 13: 55,156,494 D116N probably null Het
Flt3 A G 5: 147,356,243 Y518H possibly damaging Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Gk2 T A 5: 97,455,352 L542F possibly damaging Het
Gm4922 T A 10: 18,784,614 E120V probably damaging Het
Hip1 A T 5: 135,428,764 I285N probably benign Het
Kcnd2 C A 6: 21,217,096 D266E probably damaging Het
Kdr C T 5: 75,972,429 W63* probably null Het
Kit A G 5: 75,609,318 D130G probably benign Het
Megf8 G A 7: 25,359,202 V2208I probably benign Het
Neto2 G A 8: 85,674,118 T16I probably damaging Het
Nktr T A 9: 121,749,069 probably benign Het
Nrxn1 A G 17: 90,208,421 I1207T probably damaging Het
Obox7 G A 7: 14,664,047 G4D probably benign Het
Ogdh G A 11: 6,350,655 W827* probably null Het
Olfr1223 T A 2: 89,144,130 K298* probably null Het
Olfr309 T C 7: 86,306,229 M295V probably benign Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sbpl T A 17: 23,953,643 I101L probably benign Het
Serpina9 T A 12: 104,008,892 M1L probably benign Het
Stxbp6 A G 12: 44,902,858 probably null Het
Synpo2 A G 3: 123,114,590 V359A probably damaging Het
Ttyh1 T A 7: 4,129,318 L155H probably damaging Het
Vil1 A G 1: 74,432,415 D785G probably benign Het
Zfp345 G A 2: 150,472,553 H355Y probably damaging Het
Other mutations in Olfr726
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Olfr726 APN 14 50083997 missense probably benign 0.00
IGL01432:Olfr726 APN 14 50083947 missense probably benign 0.07
IGL01788:Olfr726 APN 14 50084502 missense probably damaging 1.00
IGL01957:Olfr726 APN 14 50084280 missense probably benign 0.00
IGL02132:Olfr726 APN 14 50084486 missense probably damaging 1.00
R0611:Olfr726 UTSW 14 50083853 missense probably damaging 1.00
R0689:Olfr726 UTSW 14 50084232 missense probably benign 0.01
R1556:Olfr726 UTSW 14 50084459 missense possibly damaging 0.90
R1710:Olfr726 UTSW 14 50084370 missense probably benign 0.01
R1791:Olfr726 UTSW 14 50084042 missense probably benign 0.03
R1804:Olfr726 UTSW 14 50083902 missense probably damaging 0.99
R1853:Olfr726 UTSW 14 50084120 missense probably damaging 1.00
R2034:Olfr726 UTSW 14 50083983 missense probably benign 0.34
R3155:Olfr726 UTSW 14 50084525 missense probably benign 0.09
R3156:Olfr726 UTSW 14 50084525 missense probably benign 0.09
R4392:Olfr726 UTSW 14 50084603 missense probably benign 0.24
R4533:Olfr726 UTSW 14 50083699 unclassified probably null
R4694:Olfr726 UTSW 14 50084019 missense probably benign
R5183:Olfr726 UTSW 14 50084546 missense probably damaging 0.99
R5859:Olfr726 UTSW 14 50084027 missense probably damaging 1.00
R6186:Olfr726 UTSW 14 50084525 missense probably damaging 0.98
R6357:Olfr726 UTSW 14 50083989 missense probably damaging 0.99
R6771:Olfr726 UTSW 14 50083989 missense probably damaging 0.99
R6834:Olfr726 UTSW 14 50084228 missense probably damaging 0.99
R6924:Olfr726 UTSW 14 50083850 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GTTGGGAGACTAGTAAATGTCATG -3'
(R):5'- GTAGTTGTACTATTCTTTGGACCATGC -3'

Sequencing Primer
(F):5'- GGGAGACTAGTAAATGTCATGAAATG -3'
(R):5'- GCATGGCCCTTTAATGGCTATTCAG -3'
Posted On2015-04-17