Incidental Mutation 'R3939:4930567H17Rik'
ID308619
Institutional Source Beutler Lab
Gene Symbol 4930567H17Rik
Ensembl Gene ENSMUSG00000073141
Gene NameRIKEN cDNA 4930567H17 gene
Synonyms
MMRRC Submission 040826-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.032) question?
Stock #R3939 (G1)
Quality Score88.4
Status Not validated
ChromosomeX
Chromosomal Location70393901-70394740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70394529 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 53 (A53T)
Ref Sequence ENSEMBL: ENSMUSP00000090060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092405]
Predicted Effect probably benign
Transcript: ENSMUST00000092405
AA Change: A53T

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000090060
Gene: ENSMUSG00000073141
AA Change: A53T

DomainStartEndE-ValueType
SCOP:d1sig__ 115 223 1e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193512
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Cacnb4 C A 2: 52,469,489 R169L probably damaging Het
Col13a1 T C 10: 61,863,082 I491V unknown Het
Corin T C 5: 72,339,879 D531G possibly damaging Het
Cx3cr1 C T 9: 120,051,644 V231I probably benign Het
Dennd4c T G 4: 86,774,280 V9G probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Faf1 T G 4: 109,861,879 L394R probably damaging Het
Fgfr4 G A 13: 55,156,494 D116N probably null Het
Flt3 A G 5: 147,356,243 Y518H possibly damaging Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Gk2 T A 5: 97,455,352 L542F possibly damaging Het
Gm4922 T A 10: 18,784,614 E120V probably damaging Het
Hip1 A T 5: 135,428,764 I285N probably benign Het
Kcnd2 C A 6: 21,217,096 D266E probably damaging Het
Kdr C T 5: 75,972,429 W63* probably null Het
Kit A G 5: 75,609,318 D130G probably benign Het
Megf8 G A 7: 25,359,202 V2208I probably benign Het
Neto2 G A 8: 85,674,118 T16I probably damaging Het
Nktr T A 9: 121,749,069 probably benign Het
Nrxn1 A G 17: 90,208,421 I1207T probably damaging Het
Obox7 G A 7: 14,664,047 G4D probably benign Het
Ogdh G A 11: 6,350,655 W827* probably null Het
Olfr1223 T A 2: 89,144,130 K298* probably null Het
Olfr309 T C 7: 86,306,229 M295V probably benign Het
Olfr726 A G 14: 50,083,716 *322Q probably null Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sbpl T A 17: 23,953,643 I101L probably benign Het
Serpina9 T A 12: 104,008,892 M1L probably benign Het
Stxbp6 A G 12: 44,902,858 probably null Het
Synpo2 A G 3: 123,114,590 V359A probably damaging Het
Ttyh1 T A 7: 4,129,318 L155H probably damaging Het
Vil1 A G 1: 74,432,415 D785G probably benign Het
Zfp345 G A 2: 150,472,553 H355Y probably damaging Het
Other mutations in 4930567H17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0737:4930567H17Rik UTSW X 70394207 unclassified probably benign
R2257:4930567H17Rik UTSW X 70394406 missense probably damaging 1.00
R3919:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R3940:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R4231:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R4232:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R4234:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R4235:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R4236:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CAGGATGTATCTGCATGGGTC -3'
(R):5'- TAGCACTCAGTGGCCACTAC -3'

Sequencing Primer
(F):5'- TCGTATGAAGACAACGTCCGGC -3'
(R):5'- CTGTCTTAGAAAGTCAGGCAGTC -3'
Posted On2015-04-17