Mutagenetix > Incidental Mutation

Incidental Mutation 'R3929:Rp1'

308620

Institutional Source

Beutler Lab

Gene Symbol

Rp1

Ensembl Gene

ENSMUSG00000025900

Gene Name

retinitis pigmentosa 1 (human)

Synonyms

Dcdc3, Orp1, mG145, Rp1h, oxygen-regulated protein 1

MMRRC Submission

040824-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.105) question?

Stock #

R3929 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4185896-4479508 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 4422868 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 71 (T71A)

Ref Sequence

ENSEMBL: ENSMUSP00000146439 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027032] [ENSMUST00000194992] [ENSMUST00000208660]

AlphaFold

P56716

Predicted Effect

probably damaging
Transcript: ENSMUST00000027032
AA Change: T61A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000027032
Gene: ENSMUSG00000025900
AA Change: T61A

Domain	Start	End	E-Value	Type
DCX	30	117	4.37e-39	SMART
low complexity region	120	133	N/A	INTRINSIC
DCX	152	236	7.17e-35	SMART
low complexity region	343	354	N/A	INTRINSIC
low complexity region	403	414	N/A	INTRINSIC
low complexity region	462	473	N/A	INTRINSIC
low complexity region	646	661	N/A	INTRINSIC
low complexity region	1113	1123	N/A	INTRINSIC
low complexity region	1396	1412	N/A	INTRINSIC
low complexity region	1434	1444	N/A	INTRINSIC
low complexity region	1648	1661	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000194992
AA Change: T71A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000142146
Gene: ENSMUSG00000025900
AA Change: T71A

Domain	Start	End	E-Value	Type
DCX	40	127	4.37e-39	SMART
low complexity region	130	143	N/A	INTRINSIC
DCX	162	246	7.17e-35	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000208660
AA Change: T71A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208793

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. The encoded protein is a photoreceptor microtubule-associated protein and is required for correct stacking of outer segment disc. This protein and the RP1L1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Because of its response to in vivo retinal oxygen levels, this protein was initially named ORP1 (oxygen-regulated protein-1). This protein was subsequently designated RP1 (retinitis pigmentosa 1) when it was found that mutations in this gene cause autosomal dominant retinitis pigmentosa. Mutations in this gene also cause autosomal recessive retinitis pigmentosa. Two transcript variants encoding distinct isoforms are resulted from alternative promoters and alternative splicing. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience progressive degeneration in photoreceptors but are otherwise phenotypically normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ak5	A	C	3: 152,373,444 (GRCm39)	L18R	probably damaging	Het
Atrx	T	C	X: 104,923,523 (GRCm39)	I157V	possibly damaging	Het
C9	T	A	15: 6,496,939 (GRCm39)	I212N	probably benign	Het
Cabin1	T	C	10: 75,587,452 (GRCm39)		probably null	Het
Ccnf	A	G	17: 24,453,356 (GRCm39)	V361A	probably damaging	Het
Ctps1	T	A	4: 120,399,093 (GRCm39)	H553L	probably benign	Het
Dmrta1	C	T	4: 89,579,681 (GRCm39)	Q214*	probably null	Het
E230025N22Rik	T	C	18: 36,824,625 (GRCm39)	D112G	probably damaging	Het
Frat1	T	C	19: 41,819,087 (GRCm39)	C161R	probably damaging	Het
H1f8	A	G	6: 115,925,757 (GRCm39)	K185E	probably benign	Het
Itpr2	C	A	6: 146,275,857 (GRCm39)		probably null	Het
Klhl40	A	G	9: 121,609,742 (GRCm39)	D509G	probably benign	Het
Muc5ac	T	C	7: 141,356,629 (GRCm39)	V1072A	probably benign	Het
Nav3	A	G	10: 109,520,064 (GRCm39)	Y2340H	probably damaging	Het
Or10ak9	T	C	4: 118,726,179 (GRCm39)	L66P	probably damaging	Het
Or2y17	A	T	11: 49,231,820 (GRCm39)	M154L	probably benign	Het
Or51a43	C	T	7: 103,717,791 (GRCm39)	C149Y	probably benign	Het
Or5be3	T	A	2: 86,864,428 (GRCm39)	I46F	possibly damaging	Het
Or6c2	G	A	10: 129,362,100 (GRCm39)	M1I	probably null	Het
Prdm10	T	C	9: 31,258,432 (GRCm39)	I619T	probably damaging	Het
Rpusd4	A	G	9: 35,183,876 (GRCm39)	I202V	probably benign	Het
Sin3a	A	G	9: 57,025,421 (GRCm39)	N1089S	probably damaging	Het
St6gal2	A	G	17: 55,803,324 (GRCm39)	D353G	possibly damaging	Het
Stap2	A	C	17: 56,310,156 (GRCm39)	F50V	probably damaging	Het
Stkld1	T	A	2: 26,830,059 (GRCm39)		probably null	Het
Tars3	A	G	7: 65,333,791 (GRCm39)		probably null	Het
Tbl1xr1	G	C	3: 22,243,932 (GRCm39)	D69H	probably damaging	Het
Tnrc6c	C	T	11: 117,614,355 (GRCm39)	R838W	probably damaging	Het
Trim61	A	G	8: 65,465,969 (GRCm39)	F431L	probably benign	Het
Trmo	C	T	4: 46,382,647 (GRCm39)	G150S	probably damaging	Het
Vmn1r61	A	G	7: 5,614,176 (GRCm39)	I46T	probably benign	Het
Vmn2r19	T	C	6: 123,292,587 (GRCm39)	Y210H	probably benign	Het
Xrn1	T	C	9: 95,870,926 (GRCm39)	S584P	possibly damaging	Het

Other mutations in Rp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Rp1	APN	1	4,416,969 (GRCm39)	missense	probably damaging	0.98
IGL00593:Rp1	APN	1	4,415,626 (GRCm39)	missense	possibly damaging	0.70
IGL00956:Rp1	APN	1	4,422,435 (GRCm39)	missense	probably damaging	1.00
IGL01070:Rp1	APN	1	4,415,461 (GRCm39)	missense	probably damaging	1.00
IGL01531:Rp1	APN	1	4,419,168 (GRCm39)	missense	probably benign	0.00
IGL01668:Rp1	APN	1	4,415,941 (GRCm39)	missense	probably damaging	1.00
IGL01907:Rp1	APN	1	4,418,730 (GRCm39)	missense	possibly damaging	0.56
IGL02055:Rp1	APN	1	4,422,745 (GRCm39)	missense	probably damaging	1.00
IGL02071:Rp1	APN	1	4,415,533 (GRCm39)	missense	possibly damaging	0.46
IGL02128:Rp1	APN	1	4,417,608 (GRCm39)	missense	probably damaging	0.99
IGL02244:Rp1	APN	1	4,419,003 (GRCm39)	missense	probably benign	0.00
IGL02381:Rp1	APN	1	4,422,613 (GRCm39)	missense	probably benign	0.01
IGL02499:Rp1	APN	1	4,419,271 (GRCm39)	missense	probably benign	0.17
IGL02619:Rp1	APN	1	4,418,673 (GRCm39)	missense	possibly damaging	0.73
IGL02832:Rp1	APN	1	4,419,936 (GRCm39)	missense	probably benign	0.03
IGL02861:Rp1	APN	1	4,416,375 (GRCm39)	nonsense	probably null
IGL03288:Rp1	APN	1	4,419,747 (GRCm39)	missense	possibly damaging	0.88
IGL03290:Rp1	APN	1	4,420,264 (GRCm39)	missense	probably damaging	1.00
IGL03303:Rp1	APN	1	4,415,040 (GRCm39)	missense	probably damaging	1.00
R0041:Rp1	UTSW	1	4,414,851 (GRCm39)	missense	probably benign	0.36
R0111:Rp1	UTSW	1	4,414,983 (GRCm39)	missense	probably damaging	1.00
R0363:Rp1	UTSW	1	4,417,941 (GRCm39)	missense	probably damaging	1.00
R0440:Rp1	UTSW	1	4,415,863 (GRCm39)	missense	probably damaging	1.00
R0442:Rp1	UTSW	1	4,416,970 (GRCm39)	missense	probably benign	0.09
R0528:Rp1	UTSW	1	4,415,088 (GRCm39)	missense	possibly damaging	0.82
R0586:Rp1	UTSW	1	4,418,060 (GRCm39)	missense	possibly damaging	0.76
R0639:Rp1	UTSW	1	4,416,721 (GRCm39)	missense	probably benign	0.00
R0856:Rp1	UTSW	1	4,414,878 (GRCm39)	missense	probably benign	0.05
R0908:Rp1	UTSW	1	4,414,878 (GRCm39)	missense	probably benign	0.05
R0968:Rp1	UTSW	1	4,415,575 (GRCm39)	missense	probably benign	0.00
R1099:Rp1	UTSW	1	4,422,513 (GRCm39)	missense	possibly damaging	0.45
R1242:Rp1	UTSW	1	4,415,185 (GRCm39)	missense	probably benign	0.03
R1301:Rp1	UTSW	1	4,416,159 (GRCm39)	missense	possibly damaging	0.56
R1327:Rp1	UTSW	1	4,418,193 (GRCm39)	missense	probably benign	0.01
R1403:Rp1	UTSW	1	4,416,520 (GRCm39)	missense	possibly damaging	0.73
R1403:Rp1	UTSW	1	4,416,520 (GRCm39)	missense	possibly damaging	0.73
R1406:Rp1	UTSW	1	4,422,144 (GRCm39)	missense	possibly damaging	0.88
R1406:Rp1	UTSW	1	4,422,144 (GRCm39)	missense	possibly damaging	0.88
R1440:Rp1	UTSW	1	4,417,619 (GRCm39)	missense	probably damaging	1.00
R1509:Rp1	UTSW	1	4,418,760 (GRCm39)	missense	probably benign	0.20
R1509:Rp1	UTSW	1	4,417,917 (GRCm39)	missense	probably damaging	0.98
R1538:Rp1	UTSW	1	4,415,899 (GRCm39)	missense	probably damaging	1.00
R1609:Rp1	UTSW	1	4,419,424 (GRCm39)	missense	probably damaging	1.00
R1666:Rp1	UTSW	1	4,420,086 (GRCm39)	missense	probably damaging	1.00
R1703:Rp1	UTSW	1	4,415,392 (GRCm39)	missense	probably damaging	1.00
R1782:Rp1	UTSW	1	4,419,312 (GRCm39)	missense	probably benign	0.00
R1799:Rp1	UTSW	1	4,419,055 (GRCm39)	missense	possibly damaging	0.94
R1848:Rp1	UTSW	1	4,417,455 (GRCm39)	missense	possibly damaging	0.76
R1908:Rp1	UTSW	1	4,418,943 (GRCm39)	missense	probably damaging	0.99
R1919:Rp1	UTSW	1	4,422,894 (GRCm39)	missense	probably damaging	0.99
R2087:Rp1	UTSW	1	4,418,575 (GRCm39)	missense	probably damaging	1.00
R2211:Rp1	UTSW	1	4,418,362 (GRCm39)	missense	probably damaging	0.96
R2278:Rp1	UTSW	1	4,418,250 (GRCm39)	missense	possibly damaging	0.51
R2287:Rp1	UTSW	1	4,416,182 (GRCm39)	nonsense	probably null
R2316:Rp1	UTSW	1	4,415,863 (GRCm39)	missense	probably damaging	1.00
R2346:Rp1	UTSW	1	4,418,236 (GRCm39)	missense	probably damaging	1.00
R2878:Rp1	UTSW	1	4,418,362 (GRCm39)	missense	probably damaging	1.00
R3023:Rp1	UTSW	1	4,422,898 (GRCm39)	missense	probably damaging	1.00
R3025:Rp1	UTSW	1	4,422,898 (GRCm39)	missense	probably damaging	1.00
R3716:Rp1	UTSW	1	4,419,988 (GRCm39)	missense	probably benign	0.38
R3814:Rp1	UTSW	1	4,419,931 (GRCm39)	missense	probably benign
R4064:Rp1	UTSW	1	4,415,623 (GRCm39)	missense	probably benign	0.08
R4426:Rp1	UTSW	1	4,418,147 (GRCm39)	missense	probably benign	0.13
R4557:Rp1	UTSW	1	4,414,886 (GRCm39)	missense	possibly damaging	0.61
R4764:Rp1	UTSW	1	4,416,101 (GRCm39)	missense	probably damaging	0.96
R4845:Rp1	UTSW	1	4,419,451 (GRCm39)	missense	probably benign	0.02
R4850:Rp1	UTSW	1	4,418,898 (GRCm39)	missense	probably damaging	1.00
R4857:Rp1	UTSW	1	4,422,540 (GRCm39)	missense	probably damaging	1.00
R4857:Rp1	UTSW	1	4,422,539 (GRCm39)	missense	probably damaging	0.99
R5159:Rp1	UTSW	1	4,416,426 (GRCm39)	missense	possibly damaging	0.73
R5226:Rp1	UTSW	1	4,418,256 (GRCm39)	missense	probably benign	0.01
R5327:Rp1	UTSW	1	4,419,583 (GRCm39)	splice site	probably null
R5352:Rp1	UTSW	1	4,417,321 (GRCm39)	missense	probably benign	0.00
R5504:Rp1	UTSW	1	4,420,113 (GRCm39)	missense	probably damaging	1.00
R5527:Rp1	UTSW	1	4,416,616 (GRCm39)	missense	possibly damaging	0.75
R5529:Rp1	UTSW	1	4,416,055 (GRCm39)	missense	probably benign	0.42
R5569:Rp1	UTSW	1	4,415,460 (GRCm39)	missense	probably damaging	1.00
R5622:Rp1	UTSW	1	4,418,060 (GRCm39)	missense	possibly damaging	0.76
R5970:Rp1	UTSW	1	4,418,685 (GRCm39)	missense	probably benign	0.05
R5992:Rp1	UTSW	1	4,218,926 (GRCm39)	missense	unknown
R6004:Rp1	UTSW	1	4,267,808 (GRCm39)	missense	unknown
R6018:Rp1	UTSW	1	4,423,059 (GRCm39)	missense	possibly damaging	0.83
R6074:Rp1	UTSW	1	4,415,602 (GRCm39)	missense	probably benign	0.02
R6127:Rp1	UTSW	1	4,419,534 (GRCm39)	missense	possibly damaging	0.80
R6187:Rp1	UTSW	1	4,420,092 (GRCm39)	missense	probably damaging	1.00
R6301:Rp1	UTSW	1	4,417,477 (GRCm39)	missense	probably benign	0.04
R6317:Rp1	UTSW	1	4,112,212 (GRCm39)	missense	unknown
R6405:Rp1	UTSW	1	4,415,994 (GRCm39)	missense	probably damaging	1.00
R6445:Rp1	UTSW	1	4,296,840 (GRCm39)	missense	unknown
R6466:Rp1	UTSW	1	4,418,109 (GRCm39)	missense	probably benign	0.01
R6501:Rp1	UTSW	1	4,381,503 (GRCm39)	intron	probably benign
R6547:Rp1	UTSW	1	4,240,528 (GRCm39)	missense	unknown
R6604:Rp1	UTSW	1	4,089,351 (GRCm39)	missense	unknown
R6700:Rp1	UTSW	1	4,420,119 (GRCm39)	missense	probably damaging	1.00
R6706:Rp1	UTSW	1	4,212,887 (GRCm39)	missense	unknown
R6831:Rp1	UTSW	1	4,420,087 (GRCm39)	splice site	probably null
R6918:Rp1	UTSW	1	4,069,831 (GRCm39)	missense	unknown
R6973:Rp1	UTSW	1	4,422,217 (GRCm39)	nonsense	probably null
R6981:Rp1	UTSW	1	4,415,878 (GRCm39)	missense	probably benign	0.06
R7009:Rp1	UTSW	1	4,112,291 (GRCm39)	missense	unknown
R7078:Rp1	UTSW	1	4,277,014 (GRCm39)	missense	unknown
R7112:Rp1	UTSW	1	4,419,241 (GRCm39)	missense	probably benign	0.43
R7135:Rp1	UTSW	1	4,418,391 (GRCm39)	missense	possibly damaging	0.83
R7165:Rp1	UTSW	1	4,420,140 (GRCm39)	missense	probably damaging	0.99
R7199:Rp1	UTSW	1	4,417,513 (GRCm39)	missense	possibly damaging	0.73
R7232:Rp1	UTSW	1	4,298,824 (GRCm39)	missense	unknown
R7367:Rp1	UTSW	1	4,418,221 (GRCm39)	missense	probably benign	0.42
R7484:Rp1	UTSW	1	4,415,704 (GRCm39)	missense	probably benign	0.10
R7500:Rp1	UTSW	1	4,381,501 (GRCm39)	missense	unknown
R7569:Rp1	UTSW	1	4,355,063 (GRCm39)	missense	unknown
R7642:Rp1	UTSW	1	4,218,054 (GRCm39)	missense	unknown
R7693:Rp1	UTSW	1	4,417,626 (GRCm39)	missense	probably damaging	1.00
R7742:Rp1	UTSW	1	4,240,457 (GRCm39)	missense	unknown
R7759:Rp1	UTSW	1	4,415,107 (GRCm39)	missense	probably benign
R7784:Rp1	UTSW	1	4,212,881 (GRCm39)	missense	unknown
R7816:Rp1	UTSW	1	4,417,926 (GRCm39)	missense	probably damaging	0.98
R7866:Rp1	UTSW	1	4,417,924 (GRCm39)	missense	probably benign	0.02
R8215:Rp1	UTSW	1	4,315,318 (GRCm39)	missense	unknown
R8281:Rp1	UTSW	1	4,418,139 (GRCm39)	missense	probably damaging	1.00
R8294:Rp1	UTSW	1	4,416,220 (GRCm39)	missense	probably benign	0.09
R8309:Rp1	UTSW	1	4,417,312 (GRCm39)	missense	probably benign	0.00
R8311:Rp1	UTSW	1	4,418,572 (GRCm39)	missense	probably benign	0.11
R8500:Rp1	UTSW	1	4,416,813 (GRCm39)	missense	possibly damaging	0.91
R8559:Rp1	UTSW	1	4,419,784 (GRCm39)	missense	probably damaging	1.00
R8672:Rp1	UTSW	1	4,419,007 (GRCm39)	missense	possibly damaging	0.55
R8688:Rp1	UTSW	1	4,416,628 (GRCm39)	missense	probably benign	0.01
R8792:Rp1	UTSW	1	4,095,091 (GRCm39)	missense	unknown
R8859:Rp1	UTSW	1	4,420,183 (GRCm39)	missense	probably benign	0.07
R8945:Rp1	UTSW	1	4,419,817 (GRCm39)	missense	probably benign	0.42
R8959:Rp1	UTSW	1	4,419,650 (GRCm39)	intron	probably benign
R8979:Rp1	UTSW	1	4,218,937 (GRCm39)	missense	unknown
R9126:Rp1	UTSW	1	4,417,136 (GRCm39)	missense	probably damaging	0.99
R9156:Rp1	UTSW	1	4,234,161 (GRCm39)	missense	unknown
R9160:Rp1	UTSW	1	4,416,720 (GRCm39)	missense	probably benign	0.00
R9221:Rp1	UTSW	1	4,315,266 (GRCm39)	missense	unknown
R9263:Rp1	UTSW	1	4,419,160 (GRCm39)	missense	probably benign	0.02
R9263:Rp1	UTSW	1	4,418,675 (GRCm39)	missense	probably benign	0.25
R9302:Rp1	UTSW	1	4,416,789 (GRCm39)	missense	probably damaging	1.00
R9318:Rp1	UTSW	1	4,418,488 (GRCm39)	missense	probably benign	0.09
R9414:Rp1	UTSW	1	4,313,841 (GRCm39)	missense	unknown
R9474:Rp1	UTSW	1	4,162,838 (GRCm39)	critical splice donor site	probably null
R9478:Rp1	UTSW	1	4,417,545 (GRCm39)	missense	probably benign	0.06
R9529:Rp1	UTSW	1	4,416,447 (GRCm39)	missense	probably benign
R9572:Rp1	UTSW	1	4,418,662 (GRCm39)	missense	probably benign
R9673:Rp1	UTSW	1	4,337,792 (GRCm39)	missense	unknown
R9709:Rp1	UTSW	1	4,112,255 (GRCm39)	missense	unknown
R9716:Rp1	UTSW	1	4,212,833 (GRCm39)	critical splice donor site	probably null
RF003:Rp1	UTSW	1	4,414,917 (GRCm39)	missense	probably damaging	0.99
V1662:Rp1	UTSW	1	4,419,783 (GRCm39)	missense	probably damaging	1.00
X0012:Rp1	UTSW	1	4,417,918 (GRCm39)	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TTATGGAGCGACTACTCAGCC -3'
(R):5'- GGTCTCACCCAAAATGAGTGAC -3'

Sequencing Primer
(F):5'- ACTACTCAGCCAGGGCC -3'
(R):5'- ATGAGTGACACACCTTCTACTAG -3'

Posted On

2015-04-17