Mutagenetix > Incidental Mutation

Incidental Mutation 'R3929:Prdm10'

308640

Institutional Source

Beutler Lab

Gene Symbol

Prdm10

Ensembl Gene

ENSMUSG00000042496

Gene Name

PR domain containing 10

Synonyms

LOC382066, tristanin

MMRRC Submission

040824-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3929 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31191834-31293019 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 31258432 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 619 (I619T)

Ref Sequence

ENSEMBL: ENSMUSP00000149699 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074510] [ENSMUST00000215499] [ENSMUST00000215847]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000074510
AA Change: I570T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000074104
Gene: ENSMUSG00000042496
AA Change: I570T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	111	117	N/A	INTRINSIC
PDB:3IHX\|D	133	284	1e-104	PDB
Blast:SET	165	277	3e-32	BLAST
ZnF_C2H2	300	322	5.42e-2	SMART
Pfam:Tristanin_u2	325	455	2.4e-49	PFAM
ZnF_C2H2	471	493	7.78e-3	SMART
ZnF_C2H2	501	523	1.95e-3	SMART
ZnF_C2H2	529	551	3.83e-2	SMART
ZnF_C2H2	557	580	8.34e-3	SMART
ZnF_C2H2	585	607	3.21e-4	SMART
ZnF_C2H2	613	636	3.69e-4	SMART
ZnF_C2H2	668	691	8.22e-2	SMART
ZnF_C2H2	801	824	1.25e-1	SMART
low complexity region	904	916	N/A	INTRINSIC
low complexity region	956	964	N/A	INTRINSIC
low complexity region	988	1007	N/A	INTRINSIC
low complexity region	1110	1122	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000215499
AA Change: I601T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Predicted Effect

probably damaging
Transcript: ENSMUST00000215847
AA Change: I619T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that contains C2H2-type zinc-fingers. It also contains a positive regulatory domain, which has been found in several other zinc-finger transcription factors including those involved in B cell differentiation and tumor suppression. Studies of the mouse counterpart suggest that this protein may be involved in the development of the central nerve system (CNS), as well as in the pathogenesis of neuronal storage disease. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ak5	A	C	3: 152,373,444 (GRCm39)	L18R	probably damaging	Het
Atrx	T	C	X: 104,923,523 (GRCm39)	I157V	possibly damaging	Het
C9	T	A	15: 6,496,939 (GRCm39)	I212N	probably benign	Het
Cabin1	T	C	10: 75,587,452 (GRCm39)		probably null	Het
Ccnf	A	G	17: 24,453,356 (GRCm39)	V361A	probably damaging	Het
Ctps1	T	A	4: 120,399,093 (GRCm39)	H553L	probably benign	Het
Dmrta1	C	T	4: 89,579,681 (GRCm39)	Q214*	probably null	Het
E230025N22Rik	T	C	18: 36,824,625 (GRCm39)	D112G	probably damaging	Het
Frat1	T	C	19: 41,819,087 (GRCm39)	C161R	probably damaging	Het
H1f8	A	G	6: 115,925,757 (GRCm39)	K185E	probably benign	Het
Itpr2	C	A	6: 146,275,857 (GRCm39)		probably null	Het
Klhl40	A	G	9: 121,609,742 (GRCm39)	D509G	probably benign	Het
Muc5ac	T	C	7: 141,356,629 (GRCm39)	V1072A	probably benign	Het
Nav3	A	G	10: 109,520,064 (GRCm39)	Y2340H	probably damaging	Het
Or10ak9	T	C	4: 118,726,179 (GRCm39)	L66P	probably damaging	Het
Or2y17	A	T	11: 49,231,820 (GRCm39)	M154L	probably benign	Het
Or51a43	C	T	7: 103,717,791 (GRCm39)	C149Y	probably benign	Het
Or5be3	T	A	2: 86,864,428 (GRCm39)	I46F	possibly damaging	Het
Or6c2	G	A	10: 129,362,100 (GRCm39)	M1I	probably null	Het
Rp1	T	C	1: 4,422,868 (GRCm39)	T71A	probably damaging	Het
Rpusd4	A	G	9: 35,183,876 (GRCm39)	I202V	probably benign	Het
Sin3a	A	G	9: 57,025,421 (GRCm39)	N1089S	probably damaging	Het
St6gal2	A	G	17: 55,803,324 (GRCm39)	D353G	possibly damaging	Het
Stap2	A	C	17: 56,310,156 (GRCm39)	F50V	probably damaging	Het
Stkld1	T	A	2: 26,830,059 (GRCm39)		probably null	Het
Tars3	A	G	7: 65,333,791 (GRCm39)		probably null	Het
Tbl1xr1	G	C	3: 22,243,932 (GRCm39)	D69H	probably damaging	Het
Tnrc6c	C	T	11: 117,614,355 (GRCm39)	R838W	probably damaging	Het
Trim61	A	G	8: 65,465,969 (GRCm39)	F431L	probably benign	Het
Trmo	C	T	4: 46,382,647 (GRCm39)	G150S	probably damaging	Het
Vmn1r61	A	G	7: 5,614,176 (GRCm39)	I46T	probably benign	Het
Vmn2r19	T	C	6: 123,292,587 (GRCm39)	Y210H	probably benign	Het
Xrn1	T	C	9: 95,870,926 (GRCm39)	S584P	possibly damaging	Het

Other mutations in Prdm10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Prdm10	APN	9	31,272,108 (GRCm39)	splice site	probably benign
IGL00485:Prdm10	APN	9	31,238,842 (GRCm39)	missense	possibly damaging	0.87
IGL00757:Prdm10	APN	9	31,229,842 (GRCm39)	missense	possibly damaging	0.69
IGL00836:Prdm10	APN	9	31,241,165 (GRCm39)	splice site	probably benign
IGL01505:Prdm10	APN	9	31,238,578 (GRCm39)	missense	probably benign
IGL01594:Prdm10	APN	9	31,258,149 (GRCm39)	missense	probably damaging	1.00
IGL01894:Prdm10	APN	9	31,227,557 (GRCm39)	missense	probably damaging	1.00
IGL01927:Prdm10	APN	9	31,246,694 (GRCm39)	splice site	probably benign
IGL02053:Prdm10	APN	9	31,272,144 (GRCm39)	missense	probably benign	0.00
IGL02068:Prdm10	APN	9	31,248,646 (GRCm39)	missense	probably damaging	1.00
IGL02295:Prdm10	APN	9	31,273,664 (GRCm39)	missense	probably benign
IGL02390:Prdm10	APN	9	31,264,685 (GRCm39)	missense	possibly damaging	0.68
IGL02574:Prdm10	APN	9	31,268,589 (GRCm39)	missense	probably damaging	1.00
IGL02636:Prdm10	APN	9	31,240,977 (GRCm39)	missense	possibly damaging	0.68
IGL02883:Prdm10	APN	9	31,238,644 (GRCm39)	missense	probably damaging	0.99
IGL03057:Prdm10	APN	9	31,260,481 (GRCm39)	missense	probably damaging	1.00
PIT4142001:Prdm10	UTSW	9	31,237,063 (GRCm39)	missense	probably benign	0.00
R0089:Prdm10	UTSW	9	31,227,526 (GRCm39)	missense	probably damaging	1.00
R0149:Prdm10	UTSW	9	31,227,455 (GRCm39)	splice site	probably benign
R0306:Prdm10	UTSW	9	31,227,520 (GRCm39)	missense	probably damaging	1.00
R0386:Prdm10	UTSW	9	31,227,596 (GRCm39)	missense	probably damaging	1.00
R0390:Prdm10	UTSW	9	31,260,564 (GRCm39)	critical splice donor site	probably null
R1512:Prdm10	UTSW	9	31,248,697 (GRCm39)	missense	probably damaging	1.00
R1528:Prdm10	UTSW	9	31,268,582 (GRCm39)	missense	probably damaging	1.00
R2409:Prdm10	UTSW	9	31,260,418 (GRCm39)	missense	possibly damaging	0.81
R3745:Prdm10	UTSW	9	31,251,703 (GRCm39)	missense	possibly damaging	0.72
R4295:Prdm10	UTSW	9	31,227,590 (GRCm39)	missense	possibly damaging	0.94
R4629:Prdm10	UTSW	9	31,248,612 (GRCm39)	nonsense	probably null
R4660:Prdm10	UTSW	9	31,238,624 (GRCm39)	missense	probably damaging	1.00
R4758:Prdm10	UTSW	9	31,273,708 (GRCm39)	missense	probably benign	0.00
R4793:Prdm10	UTSW	9	31,264,701 (GRCm39)	missense	probably damaging	1.00
R4798:Prdm10	UTSW	9	31,252,569 (GRCm39)	missense	probably damaging	1.00
R4806:Prdm10	UTSW	9	31,241,237 (GRCm39)	makesense	probably null
R4865:Prdm10	UTSW	9	31,258,376 (GRCm39)	missense	probably damaging	1.00
R5068:Prdm10	UTSW	9	31,270,343 (GRCm39)	missense	probably damaging	0.96
R5093:Prdm10	UTSW	9	31,252,779 (GRCm39)	missense	probably damaging	1.00
R5162:Prdm10	UTSW	9	31,251,714 (GRCm39)	missense	possibly damaging	0.90
R5656:Prdm10	UTSW	9	31,264,713 (GRCm39)	missense	probably benign	0.08
R5855:Prdm10	UTSW	9	31,248,619 (GRCm39)	missense	probably damaging	1.00
R6242:Prdm10	UTSW	9	31,252,548 (GRCm39)	missense	possibly damaging	0.67
R6396:Prdm10	UTSW	9	31,229,842 (GRCm39)	missense	possibly damaging	0.69
R6970:Prdm10	UTSW	9	31,241,119 (GRCm39)	nonsense	probably null
R7165:Prdm10	UTSW	9	31,227,738 (GRCm39)	splice site	probably null
R7177:Prdm10	UTSW	9	31,279,003 (GRCm39)	missense	probably benign
R7201:Prdm10	UTSW	9	31,227,602 (GRCm39)	missense	possibly damaging	0.87
R7313:Prdm10	UTSW	9	31,268,456 (GRCm39)	nonsense	probably null
R7337:Prdm10	UTSW	9	31,227,537 (GRCm39)	missense	probably damaging	1.00
R7511:Prdm10	UTSW	9	31,289,777 (GRCm39)	missense	probably damaging	1.00
R7711:Prdm10	UTSW	9	31,268,528 (GRCm39)	missense	probably damaging	1.00
R7855:Prdm10	UTSW	9	31,238,770 (GRCm39)	missense	probably benign	0.04
R7965:Prdm10	UTSW	9	31,258,302 (GRCm39)	missense	probably damaging	1.00
R7997:Prdm10	UTSW	9	31,264,721 (GRCm39)	missense	probably damaging	1.00
R8168:Prdm10	UTSW	9	31,258,263 (GRCm39)	missense	probably benign	0.00
R8717:Prdm10	UTSW	9	31,252,695 (GRCm39)	missense	probably benign	0.31
R8865:Prdm10	UTSW	9	31,238,693 (GRCm39)	missense	probably damaging	1.00
R8880:Prdm10	UTSW	9	31,264,742 (GRCm39)	missense	probably damaging	1.00
R9022:Prdm10	UTSW	9	31,268,424 (GRCm39)	missense	probably benign	0.01
R9200:Prdm10	UTSW	9	31,268,438 (GRCm39)	missense	probably damaging	1.00
R9288:Prdm10	UTSW	9	31,252,674 (GRCm39)	missense	possibly damaging	0.67
R9607:Prdm10	UTSW	9	31,260,486 (GRCm39)	missense	probably damaging	1.00
RF004:Prdm10	UTSW	9	31,270,422 (GRCm39)	missense	probably damaging	1.00
X0064:Prdm10	UTSW	9	31,273,747 (GRCm39)	missense	probably damaging	1.00
Z1176:Prdm10	UTSW	9	31,227,589 (GRCm39)	nonsense	probably null
Z1176:Prdm10	UTSW	9	31,227,464 (GRCm39)	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TCTCTGTAACAAGGGCTTCATC -3'
(R):5'- AACACTGATCTGAACAGCTAAGG -3'

Sequencing Primer
(F):5'- ATCAGCAGCGCCTCCTTG -3'
(R):5'- CAGGAGCTGGACAGTATG -3'

Posted On

2015-04-17