Incidental Mutation 'R3929:Ccnf'
ID 308656
Institutional Source Beutler Lab
Gene Symbol Ccnf
Ensembl Gene ENSMUSG00000072082
Gene Name cyclin F
Synonyms CycF, Fbxo1
MMRRC Submission 040824-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3929 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 24441518-24470333 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24453356 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 361 (V361A)
Ref Sequence ENSEMBL: ENSMUSP00000111048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115390]
AlphaFold P51944
Predicted Effect probably damaging
Transcript: ENSMUST00000115390
AA Change: V361A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111048
Gene: ENSMUSG00000072082
AA Change: V361A

DomainStartEndE-ValueType
FBOX 35 75 1.56e-6 SMART
CYCLIN 315 399 2.25e-13 SMART
Cyclin_C 408 531 2.58e-19 SMART
CYCLIN 416 494 2.27e-9 SMART
low complexity region 545 555 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175529
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cyclin family. Cyclins are important regulators of cell cycle transitions through their ability to bind and activate cyclin-dependent protein kinases. This member also belongs to the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it was one of the first proteins in which the F-box motif was identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E9.5 and E10.5 due to defects in yolk sac and chorioallantoic placenta maturation. Embryos show incomplete turning, underdeveloped posterior structures, neural tube closure and braindefects. MEFs have cell cycle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 A C 3: 152,373,444 (GRCm39) L18R probably damaging Het
Atrx T C X: 104,923,523 (GRCm39) I157V possibly damaging Het
C9 T A 15: 6,496,939 (GRCm39) I212N probably benign Het
Cabin1 T C 10: 75,587,452 (GRCm39) probably null Het
Ctps1 T A 4: 120,399,093 (GRCm39) H553L probably benign Het
Dmrta1 C T 4: 89,579,681 (GRCm39) Q214* probably null Het
E230025N22Rik T C 18: 36,824,625 (GRCm39) D112G probably damaging Het
Frat1 T C 19: 41,819,087 (GRCm39) C161R probably damaging Het
H1f8 A G 6: 115,925,757 (GRCm39) K185E probably benign Het
Itpr2 C A 6: 146,275,857 (GRCm39) probably null Het
Klhl40 A G 9: 121,609,742 (GRCm39) D509G probably benign Het
Muc5ac T C 7: 141,356,629 (GRCm39) V1072A probably benign Het
Nav3 A G 10: 109,520,064 (GRCm39) Y2340H probably damaging Het
Or10ak9 T C 4: 118,726,179 (GRCm39) L66P probably damaging Het
Or2y17 A T 11: 49,231,820 (GRCm39) M154L probably benign Het
Or51a43 C T 7: 103,717,791 (GRCm39) C149Y probably benign Het
Or5be3 T A 2: 86,864,428 (GRCm39) I46F possibly damaging Het
Or6c2 G A 10: 129,362,100 (GRCm39) M1I probably null Het
Prdm10 T C 9: 31,258,432 (GRCm39) I619T probably damaging Het
Rp1 T C 1: 4,422,868 (GRCm39) T71A probably damaging Het
Rpusd4 A G 9: 35,183,876 (GRCm39) I202V probably benign Het
Sin3a A G 9: 57,025,421 (GRCm39) N1089S probably damaging Het
St6gal2 A G 17: 55,803,324 (GRCm39) D353G possibly damaging Het
Stap2 A C 17: 56,310,156 (GRCm39) F50V probably damaging Het
Stkld1 T A 2: 26,830,059 (GRCm39) probably null Het
Tars3 A G 7: 65,333,791 (GRCm39) probably null Het
Tbl1xr1 G C 3: 22,243,932 (GRCm39) D69H probably damaging Het
Tnrc6c C T 11: 117,614,355 (GRCm39) R838W probably damaging Het
Trim61 A G 8: 65,465,969 (GRCm39) F431L probably benign Het
Trmo C T 4: 46,382,647 (GRCm39) G150S probably damaging Het
Vmn1r61 A G 7: 5,614,176 (GRCm39) I46T probably benign Het
Vmn2r19 T C 6: 123,292,587 (GRCm39) Y210H probably benign Het
Xrn1 T C 9: 95,870,926 (GRCm39) S584P possibly damaging Het
Other mutations in Ccnf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Ccnf APN 17 24,443,986 (GRCm39) missense probably damaging 1.00
IGL01942:Ccnf APN 17 24,461,294 (GRCm39) missense probably benign 0.03
IGL02251:Ccnf APN 17 24,445,513 (GRCm39) missense probably benign 0.00
IGL02945:Ccnf APN 17 24,443,890 (GRCm39) missense probably damaging 0.99
IGL02952:Ccnf APN 17 24,450,299 (GRCm39) missense possibly damaging 0.93
albuquerque UTSW 17 24,442,971 (GRCm39) nonsense probably null
R0326:Ccnf UTSW 17 24,450,784 (GRCm39) missense possibly damaging 0.84
R0891:Ccnf UTSW 17 24,445,751 (GRCm39) missense possibly damaging 0.93
R1069:Ccnf UTSW 17 24,442,971 (GRCm39) nonsense probably null
R1072:Ccnf UTSW 17 24,456,136 (GRCm39) missense probably damaging 0.97
R1693:Ccnf UTSW 17 24,445,514 (GRCm39) frame shift probably null
R2147:Ccnf UTSW 17 24,449,288 (GRCm39) critical splice donor site probably null
R4081:Ccnf UTSW 17 24,442,872 (GRCm39) makesense probably null
R4260:Ccnf UTSW 17 24,445,741 (GRCm39) missense probably damaging 1.00
R4579:Ccnf UTSW 17 24,450,303 (GRCm39) nonsense probably null
R4651:Ccnf UTSW 17 24,450,760 (GRCm39) missense probably damaging 1.00
R4844:Ccnf UTSW 17 24,449,331 (GRCm39) nonsense probably null
R4876:Ccnf UTSW 17 24,449,311 (GRCm39) missense probably damaging 1.00
R5234:Ccnf UTSW 17 24,453,411 (GRCm39) nonsense probably null
R5352:Ccnf UTSW 17 24,462,247 (GRCm39) splice site probably null
R5845:Ccnf UTSW 17 24,459,767 (GRCm39) missense possibly damaging 0.95
R6084:Ccnf UTSW 17 24,450,811 (GRCm39) missense probably damaging 1.00
R6219:Ccnf UTSW 17 24,445,678 (GRCm39) nonsense probably null
R7021:Ccnf UTSW 17 24,461,205 (GRCm39) missense probably damaging 1.00
R7176:Ccnf UTSW 17 24,468,376 (GRCm39) missense possibly damaging 0.54
R7180:Ccnf UTSW 17 24,442,889 (GRCm39) missense probably benign 0.00
R7485:Ccnf UTSW 17 24,468,232 (GRCm39) missense probably damaging 0.97
R7763:Ccnf UTSW 17 24,443,986 (GRCm39) missense probably damaging 1.00
R8016:Ccnf UTSW 17 24,450,784 (GRCm39) missense possibly damaging 0.84
R8034:Ccnf UTSW 17 24,450,805 (GRCm39) missense probably damaging 1.00
R8069:Ccnf UTSW 17 24,443,989 (GRCm39) missense probably damaging 1.00
R9021:Ccnf UTSW 17 24,445,679 (GRCm39) nonsense probably null
R9623:Ccnf UTSW 17 24,468,367 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGTCAACTCTGCCATCC -3'
(R):5'- CAGCTGTGATGCTTGTCCTAG -3'

Sequencing Primer
(F):5'- GCCATCCCTTCCTCGCAAAG -3'
(R):5'- CCTAGTTTTCACGGGTGGCC -3'
Posted On 2015-04-17