Incidental Mutation 'R3879:Tshz3'
ID308681
Institutional Source Beutler Lab
Gene Symbol Tshz3
Ensembl Gene ENSMUSG00000021217
Gene Nameteashirt zinc finger family member 3
SynonymsTsh3, teashirt3, A630038G13Rik, Zfp537
MMRRC Submission 040793-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3879 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location36698118-36773553 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 36771537 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 984 (Q984*)
Ref Sequence ENSEMBL: ENSMUSP00000021641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021641]
Predicted Effect probably null
Transcript: ENSMUST00000021641
AA Change: Q984*
SMART Domains Protein: ENSMUSP00000021641
Gene: ENSMUSG00000021217
AA Change: Q984*

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 123 138 N/A INTRINSIC
low complexity region 142 164 N/A INTRINSIC
ZnF_C2H2 214 238 1.86e0 SMART
ZnF_C2H2 275 299 3.83e-2 SMART
low complexity region 313 334 N/A INTRINSIC
ZnF_C2H2 386 410 5.62e0 SMART
low complexity region 483 497 N/A INTRINSIC
coiled coil region 609 630 N/A INTRINSIC
low complexity region 796 832 N/A INTRINSIC
low complexity region 855 872 N/A INTRINSIC
HOX 890 964 2.55e-4 SMART
ZnF_C2H2 976 998 8.09e0 SMART
ZnF_C2H2 1041 1064 2.4e-3 SMART
Meta Mutation Damage Score 0.606 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-finger transcription factor that regulates smooth muscle cell differentiation in the developing urinary tract. Consistent with this role, mice in which this gene has been inactivated exhibit abnormal gene expression in urinary tract smooth muscle cell precursors and kidney defects including hydronephrosis. The encoded transcription factor comprises a gene silencing complex that inhibits caspase expression. Reduced expression of this gene and consequent caspase upregulation may be correlated with progression of Alzheimer's disease in human patients. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit neoatal lethality likely due to respiratory distress and hydroureter and hydronephrosis associated with impaired development of ureteric smooth muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T C 3: 90,063,254 probably benign Het
Aass G A 6: 23,122,521 H68Y probably damaging Het
Abcc8 T A 7: 46,104,627 K1588N possibly damaging Het
Calcoco1 T C 15: 102,707,388 D601G probably damaging Het
Ccdc175 C A 12: 72,136,018 R409I probably damaging Het
Ccnl1 A G 3: 65,948,758 V242A possibly damaging Het
Clasp2 T C 9: 113,889,961 F705L probably damaging Het
Cyp46a1 A G 12: 108,358,130 T389A probably benign Het
Eps8 A G 6: 137,527,362 probably benign Het
Gm9894 T C 13: 67,764,797 noncoding transcript Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Nup153 A T 13: 46,683,960 V1262E probably damaging Het
Nup210l A G 3: 90,185,473 T1245A probably damaging Het
Olfr1480 A G 19: 13,530,249 Y236C probably damaging Het
Olfr286 C T 15: 98,227,204 C147Y probably damaging Het
Pcif1 G A 2: 164,885,958 G189D probably benign Het
Pdzd2 A G 15: 12,375,508 S1514P probably damaging Het
Pigu A T 2: 155,299,143 F276I probably damaging Het
Prame T C X: 135,613,445 H365R probably benign Het
Psmd9 C T 5: 123,234,590 probably benign Het
Rasgrp2 A T 19: 6,413,890 Q539H probably benign Het
Rgs22 T G 15: 36,106,905 I112L possibly damaging Het
Slc26a9 A T 1: 131,769,231 T786S probably benign Het
Sned1 A G 1: 93,265,030 probably benign Het
St7l G A 3: 104,926,447 V475I probably damaging Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Top3a A G 11: 60,743,939 V713A possibly damaging Het
Trim16 G A 11: 62,840,607 G348S probably damaging Het
Ttn A G 2: 76,736,062 probably null Het
Ubfd1 T A 7: 122,068,776 probably benign Het
Zfp37 A T 4: 62,191,335 Y497* probably null Het
Zfp462 G A 4: 55,060,095 C1207Y probably damaging Het
Zfp607b A G 7: 27,704,051 E644G possibly damaging Het
Other mutations in Tshz3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01875:Tshz3 APN 7 36769960 missense probably damaging 0.97
IGL01922:Tshz3 APN 7 36769605 missense probably damaging 1.00
IGL02047:Tshz3 APN 7 36770468 missense probably damaging 1.00
IGL02166:Tshz3 APN 7 36768921 missense probably benign 0.00
IGL02405:Tshz3 APN 7 36769650 missense possibly damaging 0.93
IGL02658:Tshz3 APN 7 36769158 missense probably damaging 0.99
IGL02968:Tshz3 APN 7 36769824 missense probably damaging 1.00
IGL03073:Tshz3 APN 7 36770745 missense probably damaging 1.00
IGL03233:Tshz3 APN 7 36770079 missense probably damaging 0.97
IGL03296:Tshz3 APN 7 36771336 missense probably damaging 1.00
R0049:Tshz3 UTSW 7 36770109 missense probably damaging 1.00
R0049:Tshz3 UTSW 7 36770109 missense probably damaging 1.00
R0090:Tshz3 UTSW 7 36768892 missense probably benign
R0329:Tshz3 UTSW 7 36770033 missense probably benign
R0330:Tshz3 UTSW 7 36770033 missense probably benign
R0360:Tshz3 UTSW 7 36770533 missense probably benign
R0364:Tshz3 UTSW 7 36770533 missense probably benign
R0380:Tshz3 UTSW 7 36771300 missense probably damaging 1.00
R0547:Tshz3 UTSW 7 36771417 missense probably damaging 1.00
R1061:Tshz3 UTSW 7 36768706 missense probably damaging 1.00
R1618:Tshz3 UTSW 7 36771796 missense probably damaging 1.00
R1704:Tshz3 UTSW 7 36771360 missense possibly damaging 0.92
R1881:Tshz3 UTSW 7 36771654 missense possibly damaging 0.87
R1926:Tshz3 UTSW 7 36769375 missense probably damaging 1.00
R1994:Tshz3 UTSW 7 36769822 missense probably damaging 0.99
R2404:Tshz3 UTSW 7 36770380 missense probably damaging 0.99
R2447:Tshz3 UTSW 7 36768753 missense probably benign 0.00
R2930:Tshz3 UTSW 7 36771592 missense possibly damaging 0.74
R4033:Tshz3 UTSW 7 36770584 missense possibly damaging 0.71
R4212:Tshz3 UTSW 7 36770119 missense probably damaging 1.00
R4394:Tshz3 UTSW 7 36769605 missense probably damaging 1.00
R4779:Tshz3 UTSW 7 36768972 missense probably damaging 1.00
R4977:Tshz3 UTSW 7 36771190 missense probably benign 0.31
R5139:Tshz3 UTSW 7 36771025 missense probably benign 0.23
R5448:Tshz3 UTSW 7 36771229 missense possibly damaging 0.90
R5516:Tshz3 UTSW 7 36770350 missense probably benign 0.03
R5760:Tshz3 UTSW 7 36771569 missense probably damaging 1.00
R6360:Tshz3 UTSW 7 36769441 missense probably damaging 1.00
R6481:Tshz3 UTSW 7 36752339 intron probably null
R6535:Tshz3 UTSW 7 36768789 missense probably damaging 1.00
R7105:Tshz3 UTSW 7 36769756 missense probably damaging 1.00
R7133:Tshz3 UTSW 7 36770569 missense probably benign 0.12
R7225:Tshz3 UTSW 7 36769657 missense probably damaging 1.00
R7238:Tshz3 UTSW 7 36770097 missense probably damaging 1.00
X0067:Tshz3 UTSW 7 36768796 missense probably benign 0.19
X0067:Tshz3 UTSW 7 36769321 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACATCATGTCCGATCTGAGCC -3'
(R):5'- CATGCTTGCTCGCAAAGGTC -3'

Sequencing Primer
(F):5'- ATCTGAGCCCCCAGGAG -3'
(R):5'- TGCTCGCAAAGGTCCGATTAC -3'
Posted On2015-04-17