Incidental Mutation 'R3879:Abcc8'
ID308682
Institutional Source Beutler Lab
Gene Symbol Abcc8
Ensembl Gene ENSMUSG00000040136
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 8
SynonymsD930031B21Rik, SUR1, Sur
MMRRC Submission 040793-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.541) question?
Stock #R3879 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location46104523-46180033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46104627 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 1588 (K1588N)
Ref Sequence ENSEMBL: ENSMUSP00000033123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033123] [ENSMUST00000180081] [ENSMUST00000209291] [ENSMUST00000209881] [ENSMUST00000211674]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033123
AA Change: K1588N

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000033123
Gene: ENSMUSG00000040136
AA Change: K1588N

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
transmembrane domain 105 124 N/A INTRINSIC
transmembrane domain 131 148 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 299 590 1.3e-39 PFAM
AAA 705 920 4.46e-14 SMART
low complexity region 972 994 N/A INTRINSIC
Pfam:ABC_membrane 1019 1301 1.3e-49 PFAM
AAA 1377 1570 4.33e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180081
SMART Domains Protein: ENSMUSP00000136002
Gene: ENSMUSG00000096146

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
Pfam:IRK 36 360 4.9e-138 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209291
Predicted Effect probably benign
Transcript: ENSMUST00000209432
Predicted Effect probably benign
Transcript: ENSMUST00000209881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210637
Predicted Effect unknown
Transcript: ENSMUST00000210655
AA Change: K909N
Predicted Effect unknown
Transcript: ENSMUST00000210770
AA Change: K122N
Predicted Effect probably benign
Transcript: ENSMUST00000211674
Meta Mutation Damage Score 0.0676 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions as a modulator of ATP-sensitive potassium channels and insulin release. Mutations and deficiencies in this protein have been observed in patients with hyperinsulinemic hypoglycemia of infancy, an autosomal recessive disorder of unregulated and high insulin secretion. Mutations have also been associated with non-insulin-dependent diabetes mellitus type II, an autosomal dominant disease of defective insulin secretion. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a transient neonatal hypoglycemia and a late-developing glucose intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T C 3: 90,063,254 probably benign Het
Aass G A 6: 23,122,521 H68Y probably damaging Het
Calcoco1 T C 15: 102,707,388 D601G probably damaging Het
Ccdc175 C A 12: 72,136,018 R409I probably damaging Het
Ccnl1 A G 3: 65,948,758 V242A possibly damaging Het
Clasp2 T C 9: 113,889,961 F705L probably damaging Het
Cyp46a1 A G 12: 108,358,130 T389A probably benign Het
Eps8 A G 6: 137,527,362 probably benign Het
Gm9894 T C 13: 67,764,797 noncoding transcript Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Nup153 A T 13: 46,683,960 V1262E probably damaging Het
Nup210l A G 3: 90,185,473 T1245A probably damaging Het
Olfr1480 A G 19: 13,530,249 Y236C probably damaging Het
Olfr286 C T 15: 98,227,204 C147Y probably damaging Het
Pcif1 G A 2: 164,885,958 G189D probably benign Het
Pdzd2 A G 15: 12,375,508 S1514P probably damaging Het
Pigu A T 2: 155,299,143 F276I probably damaging Het
Prame T C X: 135,613,445 H365R probably benign Het
Psmd9 C T 5: 123,234,590 probably benign Het
Rasgrp2 A T 19: 6,413,890 Q539H probably benign Het
Rgs22 T G 15: 36,106,905 I112L possibly damaging Het
Slc26a9 A T 1: 131,769,231 T786S probably benign Het
Sned1 A G 1: 93,265,030 probably benign Het
St7l G A 3: 104,926,447 V475I probably damaging Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Top3a A G 11: 60,743,939 V713A possibly damaging Het
Trim16 G A 11: 62,840,607 G348S probably damaging Het
Tshz3 C T 7: 36,771,537 Q984* probably null Het
Ttn A G 2: 76,736,062 probably null Het
Ubfd1 T A 7: 122,068,776 probably benign Het
Zfp37 A T 4: 62,191,335 Y497* probably null Het
Zfp462 G A 4: 55,060,095 C1207Y probably damaging Het
Zfp607b A G 7: 27,704,051 E644G possibly damaging Het
Other mutations in Abcc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Abcc8 APN 7 46104664 missense probably benign
IGL01457:Abcc8 APN 7 46135493 missense possibly damaging 0.51
IGL01645:Abcc8 APN 7 46115053 missense possibly damaging 0.93
IGL01683:Abcc8 APN 7 46151667 missense possibly damaging 0.78
IGL01826:Abcc8 APN 7 46124849 missense probably benign 0.01
IGL01912:Abcc8 APN 7 46120510 missense probably damaging 1.00
IGL02218:Abcc8 APN 7 46120436 missense probably benign 0.00
IGL02326:Abcc8 APN 7 46122857 critical splice donor site probably null
IGL02403:Abcc8 APN 7 46105803 splice site probably null
IGL02411:Abcc8 APN 7 46107007 missense probably damaging 1.00
IGL02653:Abcc8 APN 7 46115767
IGL02706:Abcc8 APN 7 46166921 missense probably benign 0.08
R0295:Abcc8 UTSW 7 46118054 missense probably benign
R0381:Abcc8 UTSW 7 46108434 missense possibly damaging 0.46
R0391:Abcc8 UTSW 7 46122173 missense probably damaging 0.98
R0408:Abcc8 UTSW 7 46107033 missense probably damaging 0.99
R0496:Abcc8 UTSW 7 46108820 missense probably damaging 1.00
R1126:Abcc8 UTSW 7 46109638 missense probably damaging 0.99
R1323:Abcc8 UTSW 7 46117362 missense probably benign 0.07
R1323:Abcc8 UTSW 7 46117362 missense probably benign 0.07
R1352:Abcc8 UTSW 7 46135468 splice site probably benign
R1368:Abcc8 UTSW 7 46122860 missense probably damaging 1.00
R1437:Abcc8 UTSW 7 46179813 missense probably damaging 1.00
R1463:Abcc8 UTSW 7 46154512 missense probably benign 0.12
R1689:Abcc8 UTSW 7 46120403 missense probably benign 0.16
R1717:Abcc8 UTSW 7 46115815 missense possibly damaging 0.91
R1804:Abcc8 UTSW 7 46120479 missense probably benign 0.02
R1848:Abcc8 UTSW 7 46166902 missense probably benign
R1870:Abcc8 UTSW 7 46123915 missense probably benign 0.05
R1938:Abcc8 UTSW 7 46175371 missense possibly damaging 0.49
R1993:Abcc8 UTSW 7 46117423 splice site probably null
R1994:Abcc8 UTSW 7 46157119 missense probably benign 0.02
R2511:Abcc8 UTSW 7 46150780 missense probably damaging 1.00
R3840:Abcc8 UTSW 7 46108100 missense possibly damaging 0.67
R4444:Abcc8 UTSW 7 46136194 missense probably benign 0.09
R4463:Abcc8 UTSW 7 46106581 splice site probably null
R4761:Abcc8 UTSW 7 46113075 missense probably damaging 1.00
R4816:Abcc8 UTSW 7 46104707 missense probably benign 0.01
R4841:Abcc8 UTSW 7 46150828 missense probably damaging 1.00
R4842:Abcc8 UTSW 7 46150828 missense probably damaging 1.00
R4870:Abcc8 UTSW 7 46107259 nonsense probably null
R4969:Abcc8 UTSW 7 46105519 missense probably benign 0.02
R4975:Abcc8 UTSW 7 46150867 missense probably damaging 0.98
R5258:Abcc8 UTSW 7 46108387 missense probably benign
R5258:Abcc8 UTSW 7 46157148 missense probably benign 0.17
R5502:Abcc8 UTSW 7 46108838 missense probably benign 0.00
R5518:Abcc8 UTSW 7 46120449 missense probably benign
R5660:Abcc8 UTSW 7 46108404 missense probably benign 0.15
R5902:Abcc8 UTSW 7 46115039 missense probably benign
R5907:Abcc8 UTSW 7 46123906 missense probably benign 0.01
R6023:Abcc8 UTSW 7 46108419 missense possibly damaging 0.62
R6026:Abcc8 UTSW 7 46167000 missense probably benign
R6078:Abcc8 UTSW 7 46105844 missense probably benign 0.01
R6079:Abcc8 UTSW 7 46105844 missense probably benign 0.01
R6103:Abcc8 UTSW 7 46119021 missense possibly damaging 0.50
R6221:Abcc8 UTSW 7 46175450 missense probably benign 0.01
R6511:Abcc8 UTSW 7 46150861 missense possibly damaging 0.82
U15987:Abcc8 UTSW 7 46105844 missense probably benign 0.01
Z1088:Abcc8 UTSW 7 46138065 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAATTGCCATCTTCGAGTCG -3'
(R):5'- CTATGAACTCCTCCAGGCTG -3'

Sequencing Primer
(F):5'- CCATCTTCGAGTCGGCTTGG -3'
(R):5'- AGGTCCTCCTCTGTCCCG -3'
Posted On2015-04-17