Incidental Mutation 'R3879:Nup153'
ID308691
Institutional Source Beutler Lab
Gene Symbol Nup153
Ensembl Gene ENSMUSG00000021374
Gene Namenucleoporin 153
SynonymsB130015D15Rik
MMRRC Submission 040793-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R3879 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location46679905-46727940 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46683960 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1262 (V1262E)
Ref Sequence ENSEMBL: ENSMUSP00000021803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021803]
Predicted Effect probably damaging
Transcript: ENSMUST00000021803
AA Change: V1262E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021803
Gene: ENSMUSG00000021374
AA Change: V1262E

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Pfam:Nup153 114 627 6e-236 PFAM
ZnF_RBZ 656 680 6.56e-6 SMART
ZnF_RBZ 719 743 5.89e-8 SMART
low complexity region 756 775 N/A INTRINSIC
ZnF_RBZ 787 811 7.2e-3 SMART
low complexity region 815 830 N/A INTRINSIC
ZnF_RBZ 844 868 1.64e-6 SMART
low complexity region 898 911 N/A INTRINSIC
low complexity region 1078 1085 N/A INTRINSIC
low complexity region 1183 1207 N/A INTRINSIC
low complexity region 1248 1260 N/A INTRINSIC
low complexity region 1271 1296 N/A INTRINSIC
Pfam:Nup_retrotrp_bd 1372 1462 4.4e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182914
Predicted Effect probably benign
Transcript: ENSMUST00000224203
Meta Mutation Damage Score 0.0296 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear pore complexes regulate the transport of macromolecules between the nucleus and cytoplasm. They are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. Nucleoporins are glycoproteins found in nuclear pores and contain characteristic pentapeptide XFXFG repeats as well as O-linked N-acetylglucosamine residues oriented towards the cytoplasm. The protein encoded by this gene has three distinct domains: a N-terminal region containing a pore targeting and an RNA-binding domain domain, a central region containing multiple zinc finger motifs, and a C-terminal region containing multiple XFXFG repeats. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T C 3: 90,063,254 probably benign Het
Aass G A 6: 23,122,521 H68Y probably damaging Het
Abcc8 T A 7: 46,104,627 K1588N possibly damaging Het
Calcoco1 T C 15: 102,707,388 D601G probably damaging Het
Ccdc175 C A 12: 72,136,018 R409I probably damaging Het
Ccnl1 A G 3: 65,948,758 V242A possibly damaging Het
Clasp2 T C 9: 113,889,961 F705L probably damaging Het
Cyp46a1 A G 12: 108,358,130 T389A probably benign Het
Eps8 A G 6: 137,527,362 probably benign Het
Gm9894 T C 13: 67,764,797 noncoding transcript Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Nup210l A G 3: 90,185,473 T1245A probably damaging Het
Olfr1480 A G 19: 13,530,249 Y236C probably damaging Het
Olfr286 C T 15: 98,227,204 C147Y probably damaging Het
Pcif1 G A 2: 164,885,958 G189D probably benign Het
Pdzd2 A G 15: 12,375,508 S1514P probably damaging Het
Pigu A T 2: 155,299,143 F276I probably damaging Het
Prame T C X: 135,613,445 H365R probably benign Het
Psmd9 C T 5: 123,234,590 probably benign Het
Rasgrp2 A T 19: 6,413,890 Q539H probably benign Het
Rgs22 T G 15: 36,106,905 I112L possibly damaging Het
Slc26a9 A T 1: 131,769,231 T786S probably benign Het
Sned1 A G 1: 93,265,030 probably benign Het
St7l G A 3: 104,926,447 V475I probably damaging Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Top3a A G 11: 60,743,939 V713A possibly damaging Het
Trim16 G A 11: 62,840,607 G348S probably damaging Het
Tshz3 C T 7: 36,771,537 Q984* probably null Het
Ttn A G 2: 76,736,062 probably null Het
Ubfd1 T A 7: 122,068,776 probably benign Het
Zfp37 A T 4: 62,191,335 Y497* probably null Het
Zfp462 G A 4: 55,060,095 C1207Y probably damaging Het
Zfp607b A G 7: 27,704,051 E644G possibly damaging Het
Other mutations in Nup153
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Nup153 APN 13 46681150 unclassified probably benign
IGL01312:Nup153 APN 13 46686824 missense probably benign 0.03
IGL01459:Nup153 APN 13 46712926 missense possibly damaging 0.84
IGL01646:Nup153 APN 13 46684107 missense possibly damaging 0.80
IGL03064:Nup153 APN 13 46693839 missense probably benign
IGL03288:Nup153 APN 13 46705205 missense possibly damaging 0.71
IGL03369:Nup153 APN 13 46700983 splice site probably null
IGL03371:Nup153 APN 13 46683152 missense probably benign 0.34
R0193:Nup153 UTSW 13 46709654 missense probably benign 0.01
R0244:Nup153 UTSW 13 46693936 missense probably benign 0.03
R0448:Nup153 UTSW 13 46717181 missense probably benign 0.00
R0943:Nup153 UTSW 13 46696772 splice site probably benign
R1219:Nup153 UTSW 13 46687219 missense probably benign 0.01
R1381:Nup153 UTSW 13 46689181 missense probably damaging 1.00
R1709:Nup153 UTSW 13 46693974 missense probably damaging 1.00
R1727:Nup153 UTSW 13 46693785 missense probably damaging 1.00
R1818:Nup153 UTSW 13 46681637 missense possibly damaging 0.94
R1824:Nup153 UTSW 13 46713747 missense probably damaging 1.00
R1928:Nup153 UTSW 13 46701026 missense probably damaging 0.98
R2108:Nup153 UTSW 13 46693510 critical splice donor site probably null
R2110:Nup153 UTSW 13 46683928 missense probably benign 0.00
R2111:Nup153 UTSW 13 46683928 missense probably benign 0.00
R2173:Nup153 UTSW 13 46701600 splice site probably benign
R2231:Nup153 UTSW 13 46709627 critical splice donor site probably null
R4634:Nup153 UTSW 13 46687230 missense possibly damaging 0.49
R4662:Nup153 UTSW 13 46687274 missense possibly damaging 0.68
R4932:Nup153 UTSW 13 46712737 nonsense probably null
R5011:Nup153 UTSW 13 46687403 missense possibly damaging 0.62
R5023:Nup153 UTSW 13 46681109 unclassified probably benign
R5069:Nup153 UTSW 13 46709792 missense probably benign 0.05
R5137:Nup153 UTSW 13 46684153 missense probably damaging 0.99
R5323:Nup153 UTSW 13 46717206 missense probably benign 0.19
R5345:Nup153 UTSW 13 46686865 nonsense probably null
R5536:Nup153 UTSW 13 46683009 missense probably benign 0.01
R5613:Nup153 UTSW 13 46687271 missense possibly damaging 0.64
R5620:Nup153 UTSW 13 46684006 nonsense probably null
R5764:Nup153 UTSW 13 46687327 missense probably damaging 0.97
R5849:Nup153 UTSW 13 46686976 missense probably damaging 0.99
R6454:Nup153 UTSW 13 46709660 unclassified probably null
R6701:Nup153 UTSW 13 46687065 missense probably benign 0.00
R6721:Nup153 UTSW 13 46701026 missense probably damaging 0.98
R6737:Nup153 UTSW 13 46689206 missense probably benign 0.08
R6789:Nup153 UTSW 13 46717316 missense probably damaging 1.00
R6820:Nup153 UTSW 13 46709983 missense probably benign 0.09
R6837:Nup153 UTSW 13 46694051 missense probably damaging 1.00
R6913:Nup153 UTSW 13 46699716 missense probably damaging 1.00
R7052:Nup153 UTSW 13 46687473 missense probably benign 0.09
R7091:Nup153 UTSW 13 46683928 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGACCTTACATGAATTGGAGGCAC -3'
(R):5'- CTAGTTCAAGTGCACCAGCC -3'

Sequencing Primer
(F):5'- CTTACATGAATTGGAGGCACACTGC -3'
(R):5'- GTGCACCAGCCACTTCATCTAG -3'
Posted On2015-04-17