Incidental Mutation 'R3885:Ovch2'
ID308712
Institutional Source Beutler Lab
Gene Symbol Ovch2
Ensembl Gene ENSMUSG00000048236
Gene Nameovochymase 2
Synonyms
MMRRC Submission 040905-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3885 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location107781544-107801208 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107796568 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 81 (I81T)
Ref Sequence ENSEMBL: ENSMUSP00000102366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106755]
Predicted Effect probably damaging
Transcript: ENSMUST00000106755
AA Change: I81T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102366
Gene: ENSMUSG00000048236
AA Change: I81T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Tryp_SPc 51 294 6.58e-93 SMART
CUB 314 421 1.68e-17 SMART
CUB 431 543 5.02e-25 SMART
Meta Mutation Damage Score 0.388 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak8 G A 2: 28,733,885 V161I possibly damaging Het
Ank3 A T 10: 69,899,036 I792F probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Boc T C 16: 44,487,613 probably benign Het
Bptf G A 11: 107,074,513 T1170M probably damaging Het
Ccdc85a T A 11: 28,576,677 E310D probably benign Het
Cfap221 A G 1: 119,954,146 probably null Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Eif2ak1 A T 5: 143,884,661 Q265L probably benign Het
Eif2s1 T A 12: 78,881,225 I225N probably damaging Het
Ephb2 C T 4: 136,771,034 G245S probably damaging Het
Exoc4 T C 6: 33,266,131 probably null Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Gck T C 11: 5,910,318 Y108C probably damaging Het
Gjc3 T A 5: 137,957,843 N60I possibly damaging Het
Gm5145 A T 17: 20,571,010 T217S probably benign Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
Gpr150 T C 13: 76,056,538 Q96R probably damaging Het
Hist1h2ae G T 13: 23,570,879 T77K possibly damaging Het
Hist1h2an A G 13: 21,786,869 L117P probably damaging Het
Itga2 A T 13: 114,869,299 H448Q probably benign Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Lrch2 C G X: 147,473,007 A437P probably damaging Het
Lrriq1 T C 10: 103,216,106 I262V probably damaging Het
Mgst3 G T 1: 167,372,562 Q135K probably benign Het
Nrxn1 T A 17: 90,623,471 T766S probably damaging Het
Olfr736 A T 14: 50,392,869 I38F probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rictor A T 15: 6,759,610 N236Y probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Senp7 A G 16: 56,186,079 E922G probably damaging Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slitrk5 T A 14: 111,679,797 C284* probably null Het
Steap4 G T 5: 7,980,494 R450L probably damaging Het
Usp40 A T 1: 87,967,269 L843Q probably damaging Het
Vmn2r97 C T 17: 18,928,334 L164F possibly damaging Het
Wiz G T 17: 32,357,038 A798E possibly damaging Het
Other mutations in Ovch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Ovch2 APN 7 107789090 missense probably null 1.00
IGL02198:Ovch2 APN 7 107794834 missense probably damaging 0.99
IGL02200:Ovch2 APN 7 107794823 missense probably damaging 1.00
IGL02442:Ovch2 APN 7 107796548 missense possibly damaging 0.90
IGL02531:Ovch2 APN 7 107790198 missense probably damaging 1.00
IGL02862:Ovch2 APN 7 107794931 missense probably damaging 1.00
R0401:Ovch2 UTSW 7 107801136 missense probably damaging 0.98
R0413:Ovch2 UTSW 7 107782036 missense probably benign
R0631:Ovch2 UTSW 7 107782021 missense probably benign 0.01
R1028:Ovch2 UTSW 7 107796548 missense probably benign 0.37
R1329:Ovch2 UTSW 7 107785446 missense probably damaging 1.00
R1809:Ovch2 UTSW 7 107790205 critical splice acceptor site probably null
R2254:Ovch2 UTSW 7 107790195 missense probably benign 0.02
R2265:Ovch2 UTSW 7 107784575 missense probably damaging 1.00
R2358:Ovch2 UTSW 7 107794915 missense probably damaging 1.00
R2922:Ovch2 UTSW 7 107790389 missense possibly damaging 0.88
R2923:Ovch2 UTSW 7 107790389 missense possibly damaging 0.88
R3034:Ovch2 UTSW 7 107785492 missense probably damaging 1.00
R3957:Ovch2 UTSW 7 107789111 missense probably damaging 0.99
R4687:Ovch2 UTSW 7 107796548 missense possibly damaging 0.90
R5307:Ovch2 UTSW 7 107792134 missense probably benign 0.26
R5353:Ovch2 UTSW 7 107794424 missense probably damaging 0.98
R5688:Ovch2 UTSW 7 107793994 missense probably damaging 1.00
R5730:Ovch2 UTSW 7 107793399 missense probably damaging 1.00
R5767:Ovch2 UTSW 7 107781978 missense probably benign
R5979:Ovch2 UTSW 7 107794388 missense possibly damaging 0.94
R6039:Ovch2 UTSW 7 107789111 missense probably damaging 0.99
R6039:Ovch2 UTSW 7 107789111 missense probably damaging 0.99
R6064:Ovch2 UTSW 7 107796572 missense probably damaging 0.98
R6247:Ovch2 UTSW 7 107785441 missense probably damaging 1.00
R6638:Ovch2 UTSW 7 107789094 missense probably benign 0.17
R6877:Ovch2 UTSW 7 107790108 missense probably benign 0.25
R7040:Ovch2 UTSW 7 107796565 missense probably damaging 1.00
R7257:Ovch2 UTSW 7 107794433 missense probably damaging 1.00
R7282:Ovch2 UTSW 7 107794370 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TAAATACAGCATCTTGCCTCTGC -3'
(R):5'- ACTGTCGTGATGCCTGAGTC -3'

Sequencing Primer
(F):5'- ACCTGAGAATTAGCCTACAATGTC -3'
(R):5'- CGTGATGCCTGAGTCATGATCAC -3'
Posted On2015-04-17